Transcript: Mouse XM_006501116.1

PREDICTED: Mus musculus neuropeptide Y receptor Y2 (Npy2r), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Npy2r (18167)
Length:
4259
CDS:
1186..2331

Additional Resources:

NCBI RefSeq record:
XM_006501116.1
NBCI Gene record:
Npy2r (18167)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501116.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027512 GCTGCTAAACAACTCAGATTT pLKO.1 2710 3UTR 100% 13.200 18.480 N Npy2r n/a
2 TRCN0000027507 CGGTACAAGTGTCCACAATAA pLKO.1 1583 CDS 100% 13.200 9.240 N Npy2r n/a
3 TRCN0000027555 GCAGAGGCAGATGAGAATCAA pLKO.1 1201 CDS 100% 5.625 3.938 N Npy2r n/a
4 TRCN0000027578 CCCTGGTAATCCATGTGGTAA pLKO.1 1391 CDS 100% 4.950 3.465 N Npy2r n/a
5 TRCN0000027571 CCTGCCATTCACTCTTACCTA pLKO.1 1494 CDS 100% 3.000 2.100 N Npy2r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501116.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01109 pDONR223 100% 87.5% 94.2% None (many diffs) n/a
2 ccsbBroad304_01109 pLX_304 0% 87.5% 94.2% V5 (many diffs) n/a
3 TRCN0000480898 TACTCTTTCATGAAAGGTCACTAT pLX_317 34.1% 87.5% 94.2% V5 (many diffs) n/a
4 TRCN0000491953 ACACTCGCATTCTAACTTGCCGCG pLX_317 30.8% 87.5% 94.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488664 TATTCGTGAGCATATAGGTTTATT pLX_317 27.8% 87.1% 93.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV