Construct: ORF TRCN0000488680
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020326.1_s317c1
- DNA Barcode:
- AAACATTCTTGGGAGTCATGCGTT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- SGK2 (10110)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488680
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10110 | SGK2 | serum/glucocorticoid regula... | NM_001199264.1 | 100% | 100% | |
| 2 | human | 10110 | SGK2 | serum/glucocorticoid regula... | NM_170693.3 | 100% | 100% | |
| 3 | human | 10110 | SGK2 | serum/glucocorticoid regula... | NM_016276.3 | 85.9% | 85.9% | 1_180del |
| 4 | mouse | 27219 | Sgk2 | serum/glucocorticoid regula... | NM_013731.3 | 89% | 94% | (many diffs) |
| 5 | mouse | 27219 | Sgk2 | serum/glucocorticoid regula... | XM_006499658.3 | 89% | 94% | (many diffs) |
| 6 | mouse | 27219 | Sgk2 | serum/glucocorticoid regula... | NM_001291152.1 | 88.7% | 93.7% | (many diffs) |
| 7 | mouse | 27219 | Sgk2 | serum/glucocorticoid regula... | NM_001291154.1 | 82.2% | 86.6% | (many diffs) |
| 8 | mouse | 27219 | Sgk2 | serum/glucocorticoid regula... | XM_011239580.2 | 82.2% | 86.6% | (many diffs) |
| 9 | mouse | 27219 | Sgk2 | serum/glucocorticoid regula... | XM_006499660.3 | 71.7% | 71.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1173
- ORF length:
- 1101
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaactct agcccagctg ggaccccaag tccacagccc tccagggcca 121 atgggaacat caacctgggg ccttcagcca acccaaatgc ccagcccacg gacttcgact 181 tcctcaaagt catcggcaaa gggaactacg ggaaggtcct actggccaag cgcaagtctg 241 atggggcgtt ctatgcagtg aaggtactac agaaaaagtc catcttaaag aagaaagagc 301 agagccacat catggcagag cgcagtgtgc ttctgaagaa cgtgcggcac cccttcctcg 361 tgggcctgcg ctactccttc cagacacctg agaagctcta cttcgtgctc gactatgtca 421 acgggggaga gctcttcttc cacctgcagc gggagcgccg gttcctggag ccccgggcca 481 ggttctacgc tgctgaggtg gccagcgcca ttggctacct gcactccctc aacatcattt 541 acagggatct gaaaccagag aacattctct tggactgcca gggacacgtg gtgctgacgg 601 attttggcct ctgcaaggaa ggtgtagagc ctgaagacac cacatccaca ttctgtggta 661 cccctgagta cttggcacct gaagtgcttc ggaaagagcc ttatgatcga gcagtggact 721 ggtggtgctt gggggcagtc ctctacgaga tgctccatgg cctgccgccc ttctacagcc 781 aagatgtatc ccagatgtat gagaacattc tgcaccagcc gctacagatc cccggaggcc 841 ggacagtggc cgcctgtgac ctcctgcaaa gccTTCTCCA CAAGGACCAG AGGCAGCGGC 901 TGGGCTCCAA AGCAGACTTT CTTGAGATTA AGAACCATGT ATTCTTCAGC CCCATAAACT 961 GGGATGACCT GTACCACAAG AGGCTAACTC CACCCTTCAA CCCAAATGTG ACAGGACCTG 1021 CTGACTTGAA GCATTTTGAC CCAGAGTTCA CCCAGGAAGC TGTGTCCAAG TCCATTGGCT 1081 GTACCCCTGA CACTGTGGCC AGCAGCTCTG GGGCCTCAAG TGCATTCCTG GGATTTTCTT 1141 ATGCGCCAGA GGATGATGAC ATCTTGGATT GCTGAGACCC AGCTTTCTTG TACAAAGTGG 1201 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1261 CTAGCCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1321 AAAACATTCT TGGGAGTCAT GCGTTACGCG TTAAGTCgac aatcaacctc tggattacaa 1381 aatttgtgaa agatt