Construct: ORF TRCN0000488692
Construct Description:
- Construct Type:
 - ORF
 - Other Identifiers:
 - ORF019399.1_s317c1
 - DNA Barcode:
 - GCCCGGATTCGCGATTTCAGGGCG
 - Epitope Tag:
 - V5
 - Notes:
 - No stop codon in insert
 
Originally Annotated References:
- Gene:
 - ADORA2B (136)
 
Vector Information:
- Vector Backbone:
 - pLX_317
 - Pol II Cassette 1:
 - SV40-PuroR
 - Pol II Cassette 2:
 - EF1a-TRCN0000488692
 - Selection Marker:
 - PuroR
 - Visible Reporter:
 - n/a
 - Epitope Tag:
 - n/a
 
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows:  total nt. matches ---------------------------------- aligned length (incl. gaps)  | 
              Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows:  total aa. matches ---------------------------------- aligned length (incl. gaps)  | 
              Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 136 | ADORA2B | adenosine A2b receptor | NM_000676.2 | 99.7% | 100% | 995_996delTA | 
| 2 | human | 136 | ADORA2B | adenosine A2b receptor | XM_011523659.3 | 67.7% | 67.1% | (many diffs) | 
| 3 | human | 136 | ADORA2B | adenosine A2b receptor | XM_017024197.2 | 67.7% | 66.2% | (many diffs) | 
| 4 | human | 136 | ADORA2B | adenosine A2b receptor | XR_001752428.1 | 43.1% | 1_523del;858_1237del;1898_2306del | |
| 5 | human | 136 | ADORA2B | adenosine A2b receptor | XM_011523661.2 | 34.3% | 33.7% | (many diffs) | 
| 6 | mouse | 11541 | Adora2b | adenosine A2b receptor | NM_007413.4 | 87.2% | 87.6% | (many diffs) | 
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
 - 75
 - ORF end:
 - 1071
 - ORF length:
 - 996
 - Sequence:
 - 
          
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgctg ctggagacac aggacgcgct gtacgtggcg ctggagctgg 121 tcatcgccgc gctttcggtg gcgggcaacg tgctggtgtg cgccgcggtg ggcacggcga 181 acactctgca gacgcccacc aactacttcc tggtgtccct ggctgcggcc gacgtggccg 241 tggggctctt cgccatcccc tttgccatca ccatcagcct gggcttctgc actgacttct 301 acggctgcct cttcctcgcc tgcttcgtgc tggtgctcac gcagagctcc atcttcagcc 361 ttctggccgt ggcagtcgac agatacctgg ccatctgtgt cccgctcagg tataaaagtt 421 tggtcacggg gacccgagca agaggggtca ttgctgtcct ctgggtcctt gcctttggca 481 tcggattgac tccattcctg gggtggaaca gtaaagacag tgccaccaac aactgcacag 541 aaccctggga tggaaccacg aatgaaagct gctgccttgt gaagtgtctc tttgagaatg 601 tggtccccat gagctacatg gtatatttca atttctttgg gtgtgttctg cccccactgc 661 ttataatgct ggtgatctac attaagatct tcctggtggc cTGCAGGCAG CTTCAGCGCA 721 CTGAGCTGAT GGACCACTCG AGGACCACCC TCCAGCGGGA GATCCATGCA GCCAAGTCAC 781 TGGCCATGAT TGTGGGGATT TTTGCCCTGT GCTGGTTACC TGTGCATGCT GTTAACTGTG 841 TCACTCTTTT CCAGCCAGCT CAGGGTAAAA ATAAGCCCAA GTGGGCAATG AATATGGCCA 901 TTCTTCTGTC ACATGCCAAT TCAGTTGTCA ATCCCATTGT CTATGCTTAC CGGAACCGAG 961 ACTTCCGCTA CACTTTTCAC AAAATTATCT CCAGGTATCT TCTCTGCCAA GCAGATGTCA 1021 AGAGTGGGAA TGGTCAGGCT GGGGTACAGC CTGCTCTCGG TGTGGGCCTA GACCCAGCTT 1081 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1141 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1201 CTTGTGGAAA GGACGAGCCC GGATTCGCGA TTTCAGGGCG ACGCGTTAAG TCgacaatca 1261 acctctggat tacaaaattt gtgaaagatt