Construct: ORF TRCN0000488753
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019131.1_s317c1
- DNA Barcode:
- CAGATCAGTTTGAACTTCGAGATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IRAK4 (51135)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488753
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001114182.2 | 99.9% | 99.7% | 1380_1381insG |
| 2 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351345.1 | 99.9% | 99.7% | 1380_1381insG |
| 3 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_016123.3 | 99.9% | 99.7% | 1380_1381insG |
| 4 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_005268943.3 | 99.9% | 99.7% | 1380_1381insG |
| 5 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_005268944.4 | 99.9% | 99.7% | 1380_1381insG |
| 6 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_005268945.4 | 99.9% | 99.7% | 1380_1381insG |
| 7 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_006719438.3 | 99.9% | 99.7% | 1380_1381insG |
| 8 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_011538431.2 | 99.9% | 99.7% | 1380_1381insG |
| 9 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_011538433.2 | 99.9% | 99.7% | 1380_1381insG |
| 10 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_017019390.2 | 99.9% | 99.7% | 1380_1381insG |
| 11 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001145256.1 | 72.9% | 72.8% | 0_1ins372;1008_1009insG |
| 12 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001145257.1 | 72.9% | 72.8% | 0_1ins372;1008_1009insG |
| 13 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001145258.1 | 72.9% | 72.8% | 0_1ins372;1008_1009insG |
| 14 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351338.1 | 72.9% | 72.8% | 0_1ins372;1008_1009insG |
| 15 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351339.1 | 72.9% | 72.8% | 0_1ins372;1008_1009insG |
| 16 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351340.1 | 72.9% | 72.8% | 0_1ins372;1008_1009insG |
| 17 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351341.1 | 72.9% | 72.8% | 0_1ins372;1008_1009insG |
| 18 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351342.1 | 72.9% | 72.8% | 0_1ins372;1008_1009insG |
| 19 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_005268949.2 | 72.9% | 72.8% | 0_1ins372;1008_1009insG |
| 20 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351343.1 | 55.8% | 53% | 0_1ins523;42_43ins86;771_772insG |
| 21 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351344.1 | 55.8% | 53% | 0_1ins523;42_43ins86;771_772insG |
| 22 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_006719440.2 | 55.8% | 53% | 0_1ins523;42_43ins86;771_772insG |
| 23 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_006719442.2 | 55.8% | 53% | 0_1ins523;42_43ins86;771_772insG |
| 24 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_024449008.1 | 50.6% | 46.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1455
- ORF length:
- 1383
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaacaaa cccataacac catcaacata tgtgcgctgc ctcaatgttg 121 gactaattag gaagctgtca gattttattg atcctcaaga aggatggaag aagttagctg 181 tagctattaa aaaaccatct ggtgatgata gatacaatca gtttcacata aggagatttg 241 aagcattact tcaaactgga aaaagtccca cttctgaatt actgtttgac tggggcacca 301 caaattgcac agttggtgat cttgtggatc ttttgatcca aaatgaattt tttgctcctg 361 cgagtctttt gctcccagat gctgttccca aaactgctaa tacactacct tctaaagaag 421 ctataacagt tcagcaaaaa cagatgcctt tctgtgacaa agacaggaca ttgatgacac 481 ctgtgcagaa tcttgaacaa agctatatgc cacctgactc ctcaagtcca gaaaataaaa 541 gtttagaagt tagtgataca cgttttcaca gtttttcatt ttatgaattg aagaatgtca 601 caaataactt tgatgaacga cccatttctg ttggtggtaa taaaatggga gagggaggat 661 ttggagttgt atataaaggc tacgtaaata acacaactgt ggcagtgaag aagcttgcag 721 caatggttga cattactact gaagaactga aacagcagtt tgatcaagaa ataaaagtaa 781 tggcaaagtg tcaacatgaa aacttagtag aactacttgg tttctcaagt gatggagatg 841 acctctgctt agtatatgtt tacatgccta atggttcatt gctagacaga ctctcttgct 901 tggatggtac tccaccactt tcttggcaca tgagatgcaa gattgctcag ggtgcagcta 961 atggcatcaa ttttctacat gaaaatcatc atattcatag agatattaaa agtgcaaata 1021 tcttactgga tgaagctttt actgctaaaa tatctgactt tggccttgca cgggcttctg 1081 agaagtttgc ccagacagtc atgactagca gaattgtggg aacaacagct tatatggcac 1141 cagaagcttt gcgtGGAGAA ATAACACCCA AATCTGATAT TTACAGCTTT GGTGTGGTTT 1201 TACTAGAAAT AATAACTGGA CTTCCAGCTG TGGATGAACA CCGTGAACCT CAGTTATTGC 1261 TAGATATTAA AGAAGAAATT GAAGATGAAG AAAAGACAAT TGAAGATTAT ATTGATAAAA 1321 AGATGAATGA TGCTGATTCC ACTTCAGTTG AAGCTATGTA CTCTGTTGCT AGTCAATGTC 1381 TGCATGAAAA GAAAAATAAG AGACCAGACA TTAAGAAGGT TCAACAGCTG CTGCAAGAGA 1441 TGACAGCTTC TGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1501 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1561 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACAG ATCAGTTTGA ACTTCGAGAT 1621 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t