Construct: ORF TRCN0000488754
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019128.1_s317c1
- DNA Barcode:
- GAAGTGTTGGCTTTGTAACCTCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ACVR2B (93)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488754
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 93 | ACVR2B | activin A receptor type 2B | NM_001106.4 | 99.9% | 99.8% | 1536_1537insG |
| 2 | human | 93 | ACVR2B | activin A receptor type 2B | XM_017007515.2 | 97.3% | 95.5% | (many diffs) |
| 3 | human | 93 | ACVR2B | activin A receptor type 2B | XM_017007514.1 | 96.3% | 95.2% | (many diffs) |
| 4 | human | 93 | ACVR2B | activin A receptor type 2B | XM_017007516.1 | 96% | 96.1% | (many diffs) |
| 5 | human | 93 | ACVR2B | activin A receptor type 2B | XM_005265583.3 | 95% | 93.8% | (many diffs) |
| 6 | mouse | 11481 | Acvr2b | activin receptor IIB | NM_001313757.1 | 92% | 99.2% | (many diffs) |
| 7 | mouse | 11481 | Acvr2b | activin receptor IIB | XM_006511926.3 | 90.5% | 97.6% | (many diffs) |
| 8 | mouse | 11481 | Acvr2b | activin receptor IIB | NM_007397.3 | 87.9% | 94.7% | (many diffs) |
| 9 | mouse | 11481 | Acvr2b | activin receptor IIB | XR_379846.3 | 13.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1611
- ORF length:
- 1539
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgacggcg ccctgggtgg ccctcgccct cctctgggga tcgctgtgcg 121 ccggctctgg gcgtggggag gctgagacac gggagtgcat ctactacaac gccaactggg 181 agctggagcg caccaaccag agcggcctgg agcgctgcga aggcgagcag gacaagcggc 241 tgcactgcta cgcctcctgg cgcaacagct ctggcaccat cgagctcgtg aagaagggct 301 gctggctaga tgacttcaac tgctacgata ggcaggagtg tgtggccact gaggagaacc 361 cccaggtgta cttctgctgc tgtgaaggca acttctgcaa cgaacgcttc actcatttgc 421 cagaggctgg gggcccggaa gtcacgtacg agccaccccc gacagccccc accctgctca 481 cggtgctggc ctactcactg ctgcccatcg ggggcctttc cctcatcgtc ctgctggcct 541 tttggatgta ccggcatcgc aagcccccct acggtcatgt ggacatccat gaggaccctg 601 ggcctccacc accatcccct ctggtgggcc tgaagccact gcagctgctg gagatcaagg 661 ctcgggggcg ctttggctgt gtctggaagg cccagctcat gaatgacttt gtagctgtca 721 agatcttccc actccaggac aagcagtcgt ggcagagtga acgggagatc ttcagcacac 781 ctggcatgaa gcacgagaac ctgctacagt tcattgctgc cgagaagcga ggctccaacc 841 tcgaagtaga gctgtggctc atcacggcct tccatgacaa gggctccctc acggattacc 901 tcaaggggaa catcatcaca tggaacgaac tgtgtcatgt agcagagacg atgtcacgag 961 gcctctcata cctgcatgag gatgtgccct ggtgccgtgg cgagggccac aagccgtcta 1021 ttgcccacag ggactttaaa agtaagaatg tattgctgaa gagcgacctc acagccgtgc 1081 tggctgactt tggcttggct gttcgatttg agccagggaa acctccaggg gacacccacg 1141 gacaggtagg cacgagacgg tacatggctc ctgaggtgct cgagggagcc atcaacttcc 1201 agagagatgc cttcctgcgc attgacatgt atgccatggg gttggtgctg tgggagcttg 1261 tgtctcgctg caaggctgca gacggacccg tggatgagta catgctgccc tttgaggaag 1321 agattggcca gcacccTTCG TTGGAGGAGC TGCAGGAGGT GGTGGTGCAC AAGAAGATGA 1381 GGCCCACCAT TAAAGATCAC TGGTTGAAAC ACCCGGGCCT GGCCCAGCTT TGTGTGACCA 1441 TCGAGGAGTG CTGGGACCAT GATGCAGAGG CTCGCTTGTC CGCGGGCTGT GTGGAGGAGC 1501 GGGTGTCCCT GATTCGGAGG TCGGTCAACG GCACTACCTC GGACTGTCTC GTTTCCCTGG 1561 TGACCTCTGT CACCAATGTG GACCTGCCCC CTAAAGAGTC AAGCATCGAC CCAGCTTTCT 1621 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1681 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTTTTCGATT TCTTGGCTTT ATATATCTTG 1741 TGGAAAGGAC GAGAAGTGTT GGCTTTGTAA CCTCCAACGC GTTAAGTCga caatcaacct 1801 ctggattaca aaatttgtga aagatt