Transcript: Human XM_017007516.1

PREDICTED: Homo sapiens activin A receptor type 2B (ACVR2B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACVR2B (93)
Length:
14783
CDS:
3438..4973

Additional Resources:

NCBI RefSeq record:
XM_017007516.1
NBCI Gene record:
ACVR2B (93)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361060 ATGTCACGAGGCCTCTCATAC pLKO_005 4314 CDS 100% 10.800 8.640 N Acvr2b n/a
2 TRCN0000000447 CTTTGGCTTGGCTGTTCGATT pLKO.1 4451 CDS 100% 4.950 3.960 N ACVR2B n/a
3 TRCN0000318686 CTTTGGCTTGGCTGTTCGATT pLKO_005 4451 CDS 100% 4.950 3.960 N ACVR2B n/a
4 TRCN0000000450 GAGGCCCACCATTAAAGATCA pLKO.1 4742 CDS 100% 4.950 3.960 N ACVR2B n/a
5 TRCN0000195571 CCCAGCTCATGAATGACTTTG pLKO.1 4054 CDS 100% 10.800 7.560 N ACVR2B n/a
6 TRCN0000199529 GACACGGGAGTGCATCTACTA pLKO.1 3509 CDS 100% 4.950 3.465 N ACVR2B n/a
7 TRCN0000318683 GACACGGGAGTGCATCTACTA pLKO_005 3509 CDS 100% 4.950 3.465 N ACVR2B n/a
8 TRCN0000000446 TGGAACGAACTGTGTCATGTA pLKO.1 4284 CDS 100% 4.950 3.465 N ACVR2B n/a
9 TRCN0000195669 CATCATCACATGGAACGAACT pLKO.1 4274 CDS 100% 4.050 2.835 N ACVR2B n/a
10 TRCN0000318685 CATCATCACATGGAACGAACT pLKO_005 4274 CDS 100% 4.050 2.835 N ACVR2B n/a
11 TRCN0000199813 GATGCCTTCCTGCGCATTGAC pLKO.1 4569 CDS 100% 1.650 1.155 N ACVR2B n/a
12 TRCN0000318687 GATGCCTTCCTGCGCATTGAC pLKO_005 4569 CDS 100% 1.650 1.155 N ACVR2B n/a
13 TRCN0000022643 CTCTCATACCTGCATGAGGAT pLKO.1 4326 CDS 100% 0.264 0.185 N Acvr2b n/a
14 TRCN0000199650 GCTGCACTGCTACGCCTCCTG pLKO.1 3602 CDS 100% 0.000 0.000 N ACVR2B n/a
15 TRCN0000000448 CTGCTGGCTAGATGACTTCAA pLKO.1 3662 CDS 100% 4.950 2.970 N ACVR2B n/a
16 TRCN0000318684 CTGCTGGCTAGATGACTTCAA pLKO_005 3662 CDS 100% 4.950 2.970 N ACVR2B n/a
17 TRCN0000000449 CAACTTCCAGAGAGATGCCTT pLKO.1 4556 CDS 100% 2.640 1.584 N ACVR2B n/a
18 TRCN0000022639 GCTGGCTAGATGACTTCAATT pLKO.1 3664 CDS 100% 13.200 9.240 N Acvr2b n/a
19 TRCN0000166364 CACACACACACACACACACAA pLKO.1 14374 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488437 CCTACCCCTGCCAGGCGCGGAAAT pLX_317 18.2% 96% 96.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488754 GAAGTGTTGGCTTTGTAACCTCCA pLX_317 18% 96% 96.1% V5 (many diffs) n/a
3 ccsbBroadEn_05770 pDONR223 100% 96% 96.3% None (many diffs) n/a
4 ccsbBroad304_05770 pLX_304 0% 96% 96.3% V5 (many diffs) n/a
5 TRCN0000476707 AACCAGTCAGATTTTGTGTCTTAC pLX_317 18% 96% 96.3% V5 (many diffs) n/a
6 ccsbBroadEn_05769 pDONR223 100% 95.9% 96.3% None (many diffs) n/a
7 ccsbBroad304_05769 pLX_304 0% 95.9% 96.3% V5 (many diffs) n/a
8 TRCN0000491302 AACTCACCTAGCGGTCGATACCAT pLX_317 17.7% 95.9% 96.3% V5 (many diffs) n/a
9 ccsbBroadEn_14530 pDONR223 100% 95.4% 40.1% None (many diffs) n/a
10 ccsbBroad304_14530 pLX_304 0% 95.4% 40.1% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000475431 CGGATGAGTTATGACTAGGAGTGG pLX_317 25.6% 95.4% 40.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV