Transcript: Mouse XM_006511926.3

PREDICTED: Mus musculus activin receptor IIB (Acvr2b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acvr2b (11481)
Length:
3771
CDS:
963..2477

Additional Resources:

NCBI RefSeq record:
XM_006511926.3
NBCI Gene record:
Acvr2b (11481)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145393 CTGGAGCGCACCAACCAGAG pXPR_003 CGG 128 8% 2 0.2845 Acvr2b ACVR2B 75484
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361060 ATGTCACGAGGCCTCTCATAC pLKO_005 1818 CDS 100% 10.800 15.120 N Acvr2b n/a
2 TRCN0000360997 GAGGGCCACAAGCCTTCTATT pLKO_005 1869 CDS 100% 13.200 10.560 N Acvr2b n/a
3 TRCN0000022639 GCTGGCTAGATGACTTCAATT pLKO.1 1192 CDS 100% 13.200 9.240 N Acvr2b n/a
4 TRCN0000361059 GTGGCAGAGTGAACGGGAAAT pLKO_005 1616 CDS 100% 10.800 7.560 N Acvr2b n/a
5 TRCN0000022640 GCAGAGTGAACGGGAAATCTT pLKO.1 1619 CDS 100% 5.625 3.938 N Acvr2b n/a
6 TRCN0000000448 CTGCTGGCTAGATGACTTCAA pLKO.1 1190 CDS 100% 4.950 3.465 N ACVR2B n/a
7 TRCN0000318684 CTGCTGGCTAGATGACTTCAA pLKO_005 1190 CDS 100% 4.950 3.465 N ACVR2B n/a
8 TRCN0000022642 GCTGTGAAGATCTTCCCACTT pLKO.1 1581 CDS 100% 4.050 2.835 N Acvr2b n/a
9 TRCN0000022641 CGATGAGTACATGCTGCCCTT pLKO.1 2159 CDS 100% 2.160 1.512 N Acvr2b n/a
10 TRCN0000022643 CTCTCATACCTGCATGAGGAT pLKO.1 1830 CDS 100% 0.264 0.185 N Acvr2b n/a
11 TRCN0000360995 GAAGATGAGGCCCACGATTAA pLKO_005 2240 CDS 100% 13.200 7.920 N Acvr2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05770 pDONR223 100% 90.6% 97.8% None (many diffs) n/a
2 ccsbBroad304_05770 pLX_304 0% 90.6% 97.8% V5 (many diffs) n/a
3 TRCN0000476707 AACCAGTCAGATTTTGTGTCTTAC pLX_317 18% 90.6% 97.8% V5 (many diffs) n/a
4 ccsbBroadEn_05769 pDONR223 100% 90.5% 97.8% None (many diffs) n/a
5 ccsbBroad304_05769 pLX_304 0% 90.5% 97.8% V5 (many diffs) n/a
6 TRCN0000491302 AACTCACCTAGCGGTCGATACCAT pLX_317 17.7% 90.5% 97.8% V5 (many diffs) n/a
7 TRCN0000488437 CCTACCCCTGCCAGGCGCGGAAAT pLX_317 18.2% 90.5% 97.8% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488754 GAAGTGTTGGCTTTGTAACCTCCA pLX_317 18% 90.5% 97.6% V5 (many diffs) n/a
9 ccsbBroadEn_14530 pDONR223 100% 90% 41.2% None (many diffs) n/a
10 ccsbBroad304_14530 pLX_304 0% 90% 41.2% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000475431 CGGATGAGTTATGACTAGGAGTGG pLX_317 25.6% 90% 41.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV