Construct: ORF TRCN0000488765
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021738.1_s317c1
- DNA Barcode:
- GGTCGAAGTCGGAGCTCAATACCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- ROS1 (6098)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488765
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6098 | ROS1 | ROS proto-oncogene 1, recep... | XM_011536053.2 | 18.6% | .3% | 1_5614del |
| 2 | human | 6098 | ROS1 | ROS proto-oncogene 1, recep... | XM_017011173.1 | 18.3% | .3% | 1_5716del |
| 3 | human | 6098 | ROS1 | ROS proto-oncogene 1, recep... | XM_017011172.1 | 18.3% | .3% | 1_5719del |
| 4 | human | 6098 | ROS1 | ROS proto-oncogene 1, recep... | XM_006715548.4 | 18.2% | .3% | 1_5743del |
| 5 | human | 6098 | ROS1 | ROS proto-oncogene 1, recep... | XM_011536052.2 | 18.2% | .3% | 1_5746del |
| 6 | human | 6098 | ROS1 | ROS proto-oncogene 1, recep... | NM_002944.2 | 18.2% | .3% | 1_5758del |
| 7 | human | 6098 | ROS1 | ROS proto-oncogene 1, recep... | XM_011536051.2 | 18.2% | .3% | 1_5761del |
| 8 | human | 6098 | ROS1 | ROS proto-oncogene 1, recep... | XM_011536050.2 | 18.1% | .3% | 1_5785del |
| 9 | human | 6098 | ROS1 | ROS proto-oncogene 1, recep... | XM_011536049.2 | 18.1% | .3% | 1_5788del |
| 10 | human | 6098 | ROS1 | ROS proto-oncogene 1, recep... | XM_011536054.2 | 11.4% | .4% | 1_5788del;6600_6601ins471 |
| 11 | mouse | 19886 | Ros1 | Ros1 proto-oncogene | XM_017313858.1 | 17.1% | .3% | (many diffs) |
| 12 | mouse | 19886 | Ros1 | Ros1 proto-oncogene | XM_017313855.1 | 16.6% | .3% | (many diffs) |
| 13 | mouse | 19886 | Ros1 | Ros1 proto-oncogene | NM_011282.2 | 15.7% | .3% | (many diffs) |
| 14 | mouse | 19886 | Ros1 | Ros1 proto-oncogene | XM_011243147.2 | 15.7% | .3% | (many diffs) |
| 15 | mouse | 19886 | Ros1 | Ros1 proto-oncogene | XM_017313856.1 | 10.3% | .3% | (many diffs) |
| 16 | mouse | 19886 | Ros1 | Ros1 proto-oncogene | XM_017313857.1 | 9.3% | .3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 139
- ORF end:
- 214
- ORF length:
- 75
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttgac agtgcttata aacgaagaca aagagttggc tgagctgcga ggtctggcag 121 ccggagtagg cctggctaat gcctgctatg caatacatac tcttccaacc caagaggaga 181 ttgaaaatct tcctgccttc cctcgggaaa aactgactct gcgtctcttg ctgggaagtg 241 gagcctttgg agaagtgtat gaaggaacag cagtggacat cttaggagtt ggaagtggag 301 aaatcaaagt agcagtgaag actttgaaga agggttccac agaccaggag aagattgaat 361 tcctgaagga ggcacatctg atgagcaaat ttaatcatcc caacattctg aagcagcttg 421 gagtttgtct gctgaatgaa ccccaataca ttatcctgga actgatggag ggaggagacc 481 ttcttactta tttgcgtaaa gcccggatgg caacgtttta tggtccttta ctcaccttgg 541 ttgaccttgt agacctgtgt gtagatattt caaaaggctg tgtctacttg gaacggatgc 601 atttcattca cagggatctg gcagctagaa attgccttgt ttccgtgaaa gactatacca 661 gtccacggat agtgaagatt ggagactttg gactcgccag agacatctat aaaaatgatt 721 actatagaaa gagaggggaa ggcctgctcc cagttcggtg gatggctcca gaaagtttga 781 tggatggaat cttcactact caatctgatg tatggtcttt tggaattctg atttgggaga 841 ttttaactct tggtcatcag ccttatccag ctcattccaa ccttgatgtg ttaaactatg 901 tgcaaacagg agggagactg gagccaccaa gaaattgtcc tgatgatctg tggaatttaa 961 tgacccagtg ctgggctcaa gaacccgacc aaagacctac ttttcataga attcaggacc 1021 aacttcagtt attcagaaat tttttcttaa atagcattta taagtccaga gatgaagcaa 1081 aCAACAGTGG AGTCATAAAT GAAAGCTTTG AAGGTGAAGA TGGCGATGTG ATTTGTTTGA 1141 ATTCAGATGA CATTATGCCA GTTGCTTTAA TGGAAACGAA GAACCGAGAA GGGTTAAACT 1201 ATATGGTACT TGCTACAGAA TGTGGCCAAG GTGAAGAAAA GTCTGAGGGT CCTCTAGGCT 1261 CCCAGGAATC TGAATCTTGT GGTCTGAGGA AAGAAGAGAA GGAACCACAT GCAGACAAAG 1321 ATTTCTGCCA AGAAAAACAA GTGGCTTACT GCCCTTCTGG CAAGCCTGAA GGCCTGAACT 1381 ATGCCTGTCT CACTCACAGT GGATATGGAG ATGGGTCTGA TTAAGACCCA GCTTTCTTGT 1441 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1501 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1561 GAAAGGACGA GGTCGAAGTC GGAGCTCAAT ACCGACGCGT TAAGTCgaca atcaacctct 1621 ggattacaaa atttgtgaaa gatt