Transcript: Mouse XM_017313858.1

PREDICTED: Mus musculus Ros1 proto-oncogene (Ros1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ros1 (19886)
Length:
7691
CDS:
77..6538

Additional Resources:

NCBI RefSeq record:
XM_017313858.1
NBCI Gene record:
Ros1 (19886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023520 CCACGTCAACATACCTGATTT pLKO.1 3945 CDS 100% 13.200 10.560 N Ros1 n/a
2 TRCN0000054537 CCTCTAAGACAGGGTGAATTT pLKO.1 4313 CDS 100% 13.200 10.560 N Ros1 n/a
3 TRCN0000023519 GCCAGCGAAATTCAATCAGTT pLKO.1 2257 CDS 100% 4.950 3.960 N Ros1 n/a
4 TRCN0000023521 CCTGATGATCTGTGGAATTTA pLKO.1 6053 CDS 100% 15.000 10.500 N Ros1 n/a
5 TRCN0000054534 CGCACCTGATGAGCAAGTTTA pLKO.1 5487 CDS 100% 13.200 9.240 N Ros1 n/a
6 TRCN0000054536 CCCACTTTCCATAACATTCAA pLKO.1 6110 CDS 100% 5.625 3.938 N Ros1 n/a
7 TRCN0000054533 CGCTTGTATTGGACAGAAGTT pLKO.1 3356 CDS 100% 4.950 3.465 N Ros1 n/a
8 TRCN0000023522 CGTGTCAGATATGGATTGGTA pLKO.1 1618 CDS 100% 3.000 2.100 N Ros1 n/a
9 TRCN0000023523 CCAACATCTCTGGAGTCAAAT pLKO.1 46 5UTR 100% 13.200 7.920 N Ros1 n/a
10 TRCN0000054535 GCTGCCAACATGTCTGATGTA pLKO.1 590 CDS 100% 4.950 3.465 N Ros1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488765 GGTCGAAGTCGGAGCTCAATACCG pLX_317 25.6% 17.1% .3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV