Transcript: Human XM_011536051.2

PREDICTED: Homo sapiens ROS proto-oncogene 1, receptor tyrosine kinase (ROS1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ROS1 (6098)
Length:
7928
CDS:
308..7354

Additional Resources:

NCBI RefSeq record:
XM_011536051.2
NBCI Gene record:
ROS1 (6098)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231666 CTCGCCAGAGACATCTATAAA pLKO_005 6623 CDS 100% 15.000 21.000 N ROS1 n/a
2 TRCN0000000954 GCTGCCTAAAGTCGTGTGTAA pLKO.1 402 CDS 100% 4.950 6.930 N ROS1 n/a
3 TRCN0000195476 CCTTCGGTTGGATGCTATATA pLKO.1 1252 CDS 100% 15.000 12.000 N ROS1 n/a
4 TRCN0000231662 CCTTCGGTTGGATGCTATATA pLKO_005 1252 CDS 100% 15.000 12.000 N ROS1 n/a
5 TRCN0000231663 CACAAGCCAAGCGAATCATTT pLKO_005 1692 CDS 100% 13.200 10.560 N ROS1 n/a
6 TRCN0000000957 CCTCACCTCATAACTCTTCTT pLKO.1 3770 CDS 100% 4.950 3.960 N ROS1 n/a
7 TRCN0000023521 CCTGATGATCTGTGGAATTTA pLKO.1 6869 CDS 100% 15.000 10.500 N Ros1 n/a
8 TRCN0000196459 GCACCTTTGATTAGGAATATT pLKO.1 896 CDS 100% 15.000 10.500 N ROS1 n/a
9 TRCN0000219659 TGATAATGAGATGGGATATTA pLKO.1 3883 CDS 100% 15.000 10.500 N ROS1 n/a
10 TRCN0000231664 TGATAATGAGATGGGATATTA pLKO_005 3883 CDS 100% 15.000 10.500 N ROS1 n/a
11 TRCN0000195046 CAAGTCTTCATGTCAACATTT pLKO.1 1730 CDS 100% 13.200 9.240 N ROS1 n/a
12 TRCN0000000956 CCACAGCTACAAACCAACAAA pLKO.1 4254 CDS 100% 5.625 3.938 N ROS1 n/a
13 TRCN0000054533 CGCTTGTATTGGACAGAAGTT pLKO.1 4166 CDS 100% 4.950 3.465 N Ros1 n/a
14 TRCN0000054535 GCTGCCAACATGTCTGATGTA pLKO.1 1355 CDS 100% 4.950 3.465 N Ros1 n/a
15 TRCN0000000953 TGGGAAATAGAGAGTTGAGAT pLKO.1 7365 3UTR 100% 4.950 3.465 N ROS1 n/a
16 TRCN0000000955 GCTTGGAGTTTGTCTGCTGAA pLKO.1 6346 CDS 100% 4.050 2.835 N ROS1 n/a
17 TRCN0000219660 CTGTGGATGGAGATCTTATAT pLKO.1 4476 CDS 100% 15.000 9.000 N ROS1 n/a
18 TRCN0000231665 CTGTGGATGGAGATCTTATAT pLKO_005 4476 CDS 100% 15.000 9.000 N ROS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488765 GGTCGAAGTCGGAGCTCAATACCG pLX_317 25.6% 18.2% .3% V5 (not translated due to prior stop codon) 1_5761del n/a
Download CSV