Construct: ORF TRCN0000488766
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021752.1_s317c1
- DNA Barcode:
- GTATAAAGGCTTACCCAGGCCAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- IL12RB1 (3594)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488766
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | NM_005535.3 | 100% | 100% | |
| 2 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | NM_001290023.2 | 99.1% | 99.3% | 1971A>G;1973_1974insCAAGGCCAAGA;1976_1980delATCGT |
| 3 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | NM_001290024.1 | 94.3% | 94.3% | 1_120del |
| 4 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_011527974.2 | 93.7% | 93.7% | (many diffs) |
| 5 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_011527975.2 | 93.5% | 93.7% | (many diffs) |
| 6 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_011527973.2 | 93.2% | 93.1% | (many diffs) |
| 7 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_011527971.3 | 92.8% | 92.8% | 1_120del;242_253del;832_852del |
| 8 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_006722741.3 | 92.6% | 92.5% | 1_120del;2105_2142delinsTG |
| 9 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_011527972.3 | 92% | 92.2% | (many diffs) |
| 10 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_011527970.2 | 91.2% | 91.1% | (many diffs) |
| 11 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_011527969.2 | 89.5% | 89.5% | (many diffs) |
| 12 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_011527968.3 | 89% | 89% | (many diffs) |
| 13 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_011527967.2 | 88.6% | 88.6% | (many diffs) |
| 14 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_011527966.2 | 88.2% | 88.1% | (many diffs) |
| 15 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_011527976.2 | 76.3% | 76% | (many diffs) |
| 16 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_017026762.1 | 65.1% | 65% | (many diffs) |
| 17 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | NM_153701.3 | 55.9% | 53.7% | (many diffs) |
| 18 | human | 3594 | IL12RB1 | interleukin 12 receptor sub... | XM_011527977.2 | 52.7% | 50.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2055
- ORF length:
- 1986
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggagccgctg gtgacctggg tggtccccct cctcttcctc ttcctgctgt 121 ccaggcaggg cgctgcctgc agaaccagtg agtgctgttt tcaggacccg ccatatccgg 181 atgcagactc aggctcggcc tcgggcccta gggacctgag atgctatcgg atatccagtg 241 atcgttacga gtgctcctgg cagtatgagg gtcccacagc tggggtcagc cacttcctgc 301 ggtgttgcct tagctccggg cgctgctgct acttcgccgc cggctcagcc accaggctgc 361 agttctccga ccaggctggg gtgtctgtgc tgtacactgt cacactctgg gtggaatcct 421 gggccaggaa ccagacagag aagtctcctg aggtgaccct gcagctctac aactcagtta 481 aatatgagcc tcctctggga gacatcaagg tgtccaagtt ggccgggcag ctgcgtatgg 541 agtgggagac cccggataac caggttggtg ctgaggtgca gttccggcac cggacaccca 601 gcagcccatg gaagttgggc gactgcggac ctcaggatga tgatactgag tcctgcctct 661 gccccctgga gatgaatgtg gcccaggaat tccagctccg acgacggcag ctggggagcc 721 aaggaagttc ctggagcaag tggagcagcc ccgtgtgcgt tccccctgaa aaccccccac 781 agcctcaggt gagattctcg gtggagcagc tgggccagga tgggaggagg cggctgaccc 841 tgaaagagca gccaacccag ctggagcttc cagaaggctg tcaagggctg gcgcctggca 901 cggaggtcac ttaccgacta cagctccaca tgctgtcctg cccgtgtaag gccaaggcca 961 ccaggaccct gcacctgggg aagatgccct atctctcggg tgctgcctac aacgtggctg 1021 tcatctcctc gaaccaattt ggtcctggcc tgaaccagac gtggcacatt cctgccgaca 1081 cccacacaga accagtggct ctgaatatca gcgtcggaac caacgggacc accatgtatt 1141 ggccagcccg ggctcagagc atgacgtatt gcattgaatg gcagcctgtg ggccaggacg 1201 ggggccttgc cacctgcagc ctgactgcgc cgcaagaccc ggatccggct ggaatggcaa 1261 cctacagctg gagtcgagag tctggggcaa tggggcagga aaagtgttac tacattacca 1321 tctttgcctc tgcgcacccc gagaagctca ccttgtggtc tacggtcctg tccacctacc 1381 actttggggg caatgcctca gcagctggga caccgcacca cgtctcggtg aagaatcata 1441 gcttggactc tgtgtctgtg gactgggcac catccctgct gagcacctgt cccggcgtcc 1501 taaaggagta tgttgtccgc tgccgagatg aagacagcaa acaggtgtca gagcatcccg 1561 tgcagcccac agagacccaa gttaccctca gtggcctgcg ggctggtgta gcctacacgg 1621 tgcaggtgcg agcagacaca gcgtggctga ggggtgtctg gagccagccc cagcgcttca 1681 gcatcgaagt gcaggtttct gattggctca tcTTCTTCGC CTCCCTGGGG AGCTTCCTGA 1741 GCATCCTTCT CGTGGGCGTC CTTGGCTACC TTGGCCTGAA CAGGGCCGCA CGGCACCTGT 1801 GCCCGCCGCT GCCCACACCC TGTGCCAGCT CCGCCATTGA GTTCCCTGGA GGGAAGGAGA 1861 CTTGGCAGTG GATCAACCCA GTGGACTTCC AGGAAGAGGC ATCCCTGCAG GAGGCCCTGG 1921 TGGTAGAGAT GTCCTGGGAC AAAGGCGAGA GGACTGAGCC TCTCGAGAAG ACAGAGCTAC 1981 CTGAGGGTGC CCCTGAGCTG GCCCTGGATA CAGAGTTGTC CTTGGAGGAT GGAGACAGGT 2041 GCAAGGCCAA GATGTGAGAC CCAGCTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 2101 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 2161 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGTATAAA GGCTTACCCA 2221 GGCCAACACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt