Transcript: Human XM_011527977.2

PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL12RB1 (3594)
Length:
2160
CDS:
245..1510

Additional Resources:

NCBI RefSeq record:
XM_011527977.2
NBCI Gene record:
IL12RB1 (3594)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058436 GACCTGAGATGCTATCGGATA pLKO.1 509 CDS 100% 4.050 5.670 N IL12RB1 n/a
2 TRCN0000058434 CAGCTCTACAACTCAGTTAAA pLKO.1 758 CDS 100% 13.200 10.560 N IL12RB1 n/a
3 TRCN0000372464 GTCATCTCCTCGAACCAATTT pLKO_005 1316 CDS 100% 13.200 10.560 N IL12RB1 n/a
4 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 2017 3UTR 100% 10.800 5.400 Y MRPS16 n/a
5 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 1549 3UTR 100% 4.950 2.475 Y LOC387873 n/a
6 TRCN0000168774 GAGATGGAGTTTCACCATGTT pLKO.1 1649 3UTR 100% 4.950 2.475 Y LOC400464 n/a
7 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1583 3UTR 100% 1.080 0.540 Y GPR83 n/a
8 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1583 3UTR 100% 1.080 0.540 Y MYORG n/a
9 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 2017 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06445 pDONR223 100% 90.2% 90.2% None (many diffs) n/a
2 ccsbBroad304_06445 pLX_304 0% 90.2% 90.2% V5 (many diffs) n/a
3 TRCN0000488766 GTATAAAGGCTTACCCAGGCCAAC pLX_317 17.6% 52.7% 50.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV