Transcript: Human XM_011527969.2

PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL12RB1 (3594)
Length:
3107
CDS:
255..2459

Additional Resources:

NCBI RefSeq record:
XM_011527969.2
NBCI Gene record:
IL12RB1 (3594)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527969.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058433 GCATGACGTATTGCATTGAAT pLKO.1 1465 CDS 100% 5.625 7.875 N IL12RB1 n/a
2 TRCN0000058436 GACCTGAGATGCTATCGGATA pLKO.1 519 CDS 100% 4.050 5.670 N IL12RB1 n/a
3 TRCN0000058434 CAGCTCTACAACTCAGTTAAA pLKO.1 768 CDS 100% 13.200 10.560 N IL12RB1 n/a
4 TRCN0000372464 GTCATCTCCTCGAACCAATTT pLKO_005 1326 CDS 100% 13.200 10.560 N IL12RB1 n/a
5 TRCN0000372529 CCAACGGGACCACCATGTATT pLKO_005 1426 CDS 100% 13.200 9.240 N IL12RB1 n/a
6 TRCN0000372530 CGTCTCGGTGAAGAATCATAG pLKO_005 1727 CDS 100% 10.800 7.560 N IL12RB1 n/a
7 TRCN0000058435 GTGTTACTACATTACCATCTT pLKO.1 1610 CDS 100% 4.950 3.465 N IL12RB1 n/a
8 TRCN0000058437 TGCCGAGATGAAGACAGCAAA pLKO.1 1827 CDS 100% 4.950 3.465 N IL12RB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527969.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488766 GTATAAAGGCTTACCCAGGCCAAC pLX_317 17.6% 89.5% 89.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_06445 pDONR223 100% 50.3% 48.3% None (many diffs) n/a
3 ccsbBroad304_06445 pLX_304 0% 50.3% 48.3% V5 (many diffs) n/a
Download CSV