Construct: ORF TRCN0000488801
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020918.1_s317c1
- DNA Barcode:
- CGGGATTTCCCTCACTCGGATCGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR173 (54328)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488801
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54328 | GPR173 | G protein-coupled receptor 173 | NM_018969.5 | 99.8% | 100% | 87G>A;1062C>T |
| 2 | human | 54328 | GPR173 | G protein-coupled receptor 173 | XM_011530798.2 | 99.8% | 100% | 87G>A;1062C>T |
| 3 | mouse | 70771 | Gpr173 | G-protein coupled receptor 173 | NM_001313748.1 | 94.6% | 99.4% | (many diffs) |
| 4 | mouse | 70771 | Gpr173 | G-protein coupled receptor 173 | NM_027543.4 | 94.6% | 99.4% | (many diffs) |
| 5 | mouse | 70771 | Gpr173 | G-protein coupled receptor 173 | XM_006528981.3 | 94.6% | 99.4% | (many diffs) |
| 6 | mouse | 70771 | Gpr173 | G-protein coupled receptor 173 | XM_006528983.3 | 94.6% | 99.4% | (many diffs) |
| 7 | mouse | 70771 | Gpr173 | G-protein coupled receptor 173 | XM_011247871.2 | 94.6% | 99.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1191
- ORF length:
- 1119
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggccaac actaccggag agcctgagga ggtgagcggc gctctgtccc 121 caccgtccgc atcagcttat gtgaagctgg tactgctagg actgattatg tgcgtgagcc 181 tggcgggtaa cgccatcttg tccctgctgg tgctcaagga gcgtgccctg cacaaggctc 241 cttactactt cctgctggac ctgtgcctgg ccgatggcat acgctctgcc gtctgcttcc 301 cctttgtgct ggcttctgtg cgccacggct cttcatggac cttcagtgca ctcagctgca 361 agattgtggc ctttatggcc gtgctctttt gcttccatgc ggccttcatg ctgttctgca 421 tcagcgtcac ccgctacatg gccatcgccc accaccgctt ctacgccaag cgcatgacac 481 tctggacatg cgcggctgtc atctgcatgg cctggaccct gtctgtggcc atggccttcc 541 cacctgtctt tgacgtgggc acctacaagt ttattcggga ggaggaccag tgcatctttg 601 agcatcgcta cttcaaggcc aatgacacgc tgggcttcat gcttatgttg gctgtgctca 661 tggcagctac ccatgctgtc tacggcaagc tgctcctctt cgagtatcgt caccgcaaga 721 tgaagccagt gcagatggtg ccagccatca gccagaactg gacattccat ggtcccgggg 781 ccaccggcca ggctgctgcc aactggatcg ccggctttgg ccgtgggccc atgccaccaa 841 cccTGCTGGG TATCCGGCAG AATGGGCATG CAGCCAGCCG GCGGCTACTG GGCATGGACG 901 AGGTCAAGGG TGAAAAGCAG CTGGGCCGCA TGTTCTACGC GATCACACTG CTCTTTCTGC 961 TCCTCTGGTC ACCCTACATC GTGGCCTGCT ACTGGCGAGT GTTTGTGAAA GCCTGTGCTG 1021 TGCCCCACCG CTACCTGGCC ACTGCTGTTT GGATGAGCTT CGCCCAGGCT GCCGTCAACC 1081 CAATTGTCTG CTTCCTGCTC AACAAGGACC TCAAGAAGTG CCTGAGGACT CATGCCCCCT 1141 GCTGGGGCAC AGGAGGTGCC CCGGCTCCCA GAGAACCCTA CTGTGTCATG TAGGACCCAG 1201 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1261 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1321 TATCTTGTGG AAAGGACGAC GGGATTTCCC TCACTCGGAT CGAACGCGTT AAGTCgacaa 1381 tcaacctctg gattacaaaa tttgtgaaag att