Construct: ORF TRCN0000488819
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019387.1_s317c1
- DNA Barcode:
- AGCGTGAACCTTCTCTCTCCGGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR4 (2828)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488819
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2828 | GPR4 | G protein-coupled receptor 4 | NM_005282.3 | 99.9% | 99.7% | 1086_1087insG |
| 2 | human | 2828 | GPR4 | G protein-coupled receptor 4 | XM_017026607.2 | 99.9% | 99.7% | 1086_1087insG |
| 3 | human | 2828 | GPR4 | G protein-coupled receptor 4 | XM_017026608.1 | 99.9% | 99.7% | 1086_1087insG |
| 4 | mouse | 319197 | Gpr4 | G protein-coupled receptor 4 | NM_175668.4 | 86.6% | 91.2% | (many diffs) |
| 5 | mouse | 319197 | Gpr4 | G protein-coupled receptor 4 | XM_006540048.3 | 86.6% | 91.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1164
- ORF length:
- 1089
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgggc aaccacacgt gggagggctg ccacgtggac tcgcgcgtgg 121 accacctctt tccgccatcc ctctacatct ttgtcatcgg cgtggggctg cccaccaact 181 gcctggctct gtgggcggcc taccgccagg tgcaacagcg caacgagctg ggcgtctacc 241 tgatgaacct cagcatcgcc gacctgctgt acatctgcac gctgccgctg tgggtggact 301 acttcctgca ccacgacaac tggatccacg gccccgggtc ctgcaagctc tttgggttca 361 tcttctacac caatatctac atcagcatcg ccttcctgtg ctgcatctcg gtggaccgct 421 acctggctgt ggcccaccca ctccgcttcg cccgcctgcg ccgcgtcaag accgccgtgg 481 ccgtgagctc cgtggtctgg gccacggagc tgggcgccaa ctcggcgccc ctgttccatg 541 acgagctctt ccgagaccgc tacaaccaca ccttctgctt tgagaagttc cccatggaag 601 gctgggtggc ctggatgaac ctctatcggg tgttcgtggg cttcctcttc ccgtgggcgc 661 tcatgctgct gtcgtaccgg ggcatcctgc gggccgtgcg gggcagcgtg tccaccgagc 721 gccaggagaa ggccaagatc aagcggctgg ccctcagcct catcgccatc gtgctggtct 781 gctttgcgcc ctatcacgtg ctcttgctgt cccgcagcgc catctacctg ggccgcccct 841 GGGACTGCGG CTTCGAGGAG CGCGTCTTTT CTGCATACCA CAGCTCACTG GCTTTCACCA 901 GCCTCAACTG TGTGGCGGAC CCCATCCTCT ACTGCCTGGT CAACGAGGGC GCCCGCAGCG 961 ATGTGGCCAA GGCCCTGCAC AACCTGCTCC GCTTTCTGGC CAGCGACAAG CCCCAGGAGA 1021 TGGCCAATGC CTCGCTCACC CTGGAGACCC CACTCACCTC CAAGAGGAAC AGCACAGCCA 1081 AAGCCATGAC TGGCAGCTGG GCGGCCACTC CGCCCTCCCA GGGGGACCAG GTGCAGCTGA 1141 AGATGCTGCC GCCAGCACAA GACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1201 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1261 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAGCG TGAACCTTCT 1321 CTCTCCGGGA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt