Construct: ORF TRCN0000488825
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021625.1_s317c1
- DNA Barcode:
- ACGCTCAATGAGTGCACGCTCACC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PCSK9 (255738)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488825
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 255738 | PCSK9 | proprotein convertase subti... | NM_174936.4 | 44.1% | 41.4% | (many diffs) |
| 2 | human | 255738 | PCSK9 | proprotein convertase subti... | NR_110451.1 | 28.6% | (many diffs) | |
| 3 | mouse | 100102 | Pcsk9 | proprotein convertase subti... | NM_153565.2 | 38.1% | 36% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1014
- ORF length:
- 945
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gtcgccttgg aaagacggag gcagcctggt ggaggtgtat ctcctagaca 121 ccagcataca gagtgaccac cgggaaatcg agggcagggt catggtcacc gacttcgaga 181 atgtgcccga ggaggacggg acccgcttcc acagacaggc cagcaagtgt gacagtcatg 241 gcacccacct ggcaggagtg gtcagcggcc gggatgccgg cgtggccaag ggtgccagca 301 tgcgcagcct gcgcgtgctc aactgccaag ggaagggcac ggttagcggc accctcatag 361 gcctggagtt tattcggaaa agccagctgg tccagcctgt ggggccactg gtggtgctgc 421 tgcccctggc gggtgggtac agccgcgtcc tcaacgccgc ctgccagcgc ctggcgaggg 481 ctggggtcgt gctggtcacc gctgccggca acttccggga cgatgcctgc ctctactccc 541 cagcctcagc tcccgaggtc atcacagttg gggccaccaa tgcccaggac cagccggtga 601 ccctggggac tttggggacc aactttggcc gctgtgtgga cctctttgcc ccaggggagg 661 acatcattgg tgcctccagc gactgcagca ccTGCTTTGT GTCACAGAGT GGGACATCAC 721 AGGCTGCTGC CCACGTGGCT GGCATTGCAG CCATGATGCT GTCTGCCGAG CCGGAGCTCA 781 CCCTGGCCGA GTTGAGGCAG AGACTGATCC ACTTCTCTGC CAAAGATGTC ATCAATGAGG 841 CCTGGTTCCC TGAGGACCAG CGGGTACTGA CCCCCAACCT GGTGGCCGCC CTGCCCCCCA 901 GCACCCATGG GGCAGGCCCT TTTTGCAGGT TGGCAGCTGT TTTGCAGGAC TGTGTGGTCA 961 GCACACTCGG GGCCTACACG GATGGCCACA GCCATCGCCC GCTGCGCCCC AGATGAGACC 1021 CAGCTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1081 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1141 ATATATCTTG TGGAAAGGAC GAACGCTCAA TGAGTGCACG CTCACCACGC GTTAAGTCga 1201 caatcaacct ctggattaca aaatttgtga aagatt