Transcript: Mouse NM_153565.2

Mus musculus proprotein convertase subtilisin/kexin type 9 (Pcsk9), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Pcsk9 (100102)
Length:
3512
CDS:
416..2500

Additional Resources:

NCBI RefSeq record:
NM_153565.2
NBCI Gene record:
Pcsk9 (100102)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153565.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032784 GTGGAGGTGTATCTCTTAGAT pLKO.1 962 CDS 100% 5.625 7.875 N Pcsk9 n/a
2 TRCN0000032787 CAGAGGCTACAGATTGAACAA pLKO.1 683 CDS 100% 4.950 6.930 N Pcsk9 n/a
3 TRCN0000032785 GCTGATCCACTTCTCTACCAA pLKO.1 1666 CDS 100% 3.000 2.100 N Pcsk9 n/a
4 TRCN0000032786 CCACTCGAACAGCTACAGCTA pLKO.1 1824 CDS 100% 2.640 1.848 N Pcsk9 n/a
5 TRCN0000032788 CCATGTCCACTGCCACCAGAA pLKO.1 2068 CDS 100% 1.350 0.945 N Pcsk9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153565.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487988 TCACGCTACTACGAAGTGGAATCA pLX_317 34.2% 38.1% 36% V5 (many diffs) n/a
2 TRCN0000488825 ACGCTCAATGAGTGCACGCTCACC pLX_317 34.5% 38.1% 36% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV