Construct: ORF TRCN0000488843
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020189.1_s317c1
- DNA Barcode:
- GAACCTGCCAACTGGCAGTAGAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- AK1 (203)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488843
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 203 | AK1 | adenylate kinase 1 | NM_000476.2 | 98.9% | 98.4% | 27G>T;580_581delAAinsTT;582_583insAAT |
2 | human | 203 | AK1 | adenylate kinase 1 | NM_001318121.1 | 98.9% | 98.4% | 27G>T;580_581delAAinsTT;582_583insAAT |
3 | human | 203 | AK1 | adenylate kinase 1 | XM_017014428.1 | 98.8% | 98.4% | (many diffs) |
4 | human | 203 | AK1 | adenylate kinase 1 | XM_024447439.1 | 91.9% | 92.3% | (many diffs) |
5 | human | 203 | AK1 | adenylate kinase 1 | NM_001318122.2 | 91.1% | 90% | (many diffs) |
6 | human | 203 | AK1 | adenylate kinase 1 | XM_024447440.1 | 68.2% | 68.2% | (many diffs) |
7 | mouse | 11636 | Ak1 | adenylate kinase 1 | NM_001198790.1 | 85.3% | 87.1% | (many diffs) |
8 | mouse | 11636 | Ak1 | adenylate kinase 1 | NM_001198791.1 | 85.3% | 87.1% | (many diffs) |
9 | mouse | 11636 | Ak1 | adenylate kinase 1 | NM_001198792.1 | 85.3% | 87.1% | (many diffs) |
10 | mouse | 11636 | Ak1 | adenylate kinase 1 | XM_006497624.3 | 85.3% | 87.1% | (many diffs) |
11 | mouse | 11636 | Ak1 | adenylate kinase 1 | NM_021515.3 | 78.4% | 79.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 657
- ORF length:
- 585
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggaagag aagctgaaga aaaccaatat catctttgtg gtgggtgggc 121 ctggctcagg gaagggcacc cagtgtgaga agatcgtgca gaagtatggc tacacccacc 181 tctccaccgg ggacctcctg cggtccgagg tcagctcagg ctcggccagg ggcaagaagc 241 tgtcggaaat catggagaag gggcagctgg ttccactgga gacagtgttg gacatgctcc 301 gggatgccat ggtggccaaa gtcaatactt ccaaaggctt ccTGATTGAT GGCTACCCGC 361 GGGAGGTGCA GCAAGGAGAA GAGTTTGAGC GACGGATTGG ACAGCCCACA CTGCTGCTGT 421 ATGTGGACGC AGGCCCTGAG ACCATGACCC AGCGGCTCTT GAAACGTGGA GAGACCAGCG 481 GGCGTGTGGA CGACAATGAG GAGACCATCA AAAAGCGGCT GGAGACCTAT TACAAGGCCA 541 CAGAACCCGT CATCGCCTTC TATGAGAAAC GTGGCATTGT GCGCAAGGTC AACGCTGAGG 601 GCTCCGTGGA CAGTGTCTTC TCCCAGGTCT GCACCCACCT GGACGCCCTA TTGAATTGAG 661 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 721 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 781 TTTATATATC TTGTGGAAAG GACGAGAACC TGCCAACTGG CAGTAGAACA CGCGTTAAGT 841 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt