Construct: ORF TRCN0000488848
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019952.1_s317c1
- DNA Barcode:
- TGCAAATTCCCTTCGAAATACTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NR2E1 (7101)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488848
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7101 | NR2E1 | nuclear receptor subfamily ... | NM_003269.5 | 99.9% | 99.7% | 1155_1156insG |
| 2 | human | 7101 | NR2E1 | nuclear receptor subfamily ... | NM_001286102.1 | 90.2% | 88.7% | (many diffs) |
| 3 | mouse | 21907 | Nr2e1 | nuclear receptor subfamily ... | NM_152229.2 | 91.7% | 98.7% | (many diffs) |
| 4 | mouse | 21907 | Nr2e1 | nuclear receptor subfamily ... | XM_006512701.2 | 90.4% | 96.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1230
- ORF length:
- 1158
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgagcaag ccagccggat caacaagccg cattttagat atcccctgca 121 aagtgtgtgg cgaccgcagc tcggggaagc actacggggt ctacgcctgc gacggctgct 181 caggtttttt caaacggagc atccgaagga ataggaccta tgtctgcaaa tctggaaacc 241 agggaggctg tccggtggac aagacgcaca gaaaccagtg cagggcgtgt cggctgaaga 301 agtgtttgga agtcaacatg aacaaagacg ccgtgcagca cgagcggggg cctcggacgt 361 ccaccatccg caagcaagtg gccctctact tccgtggaca caaggaggag aacggggccg 421 ccgcgcactt tccctcggcg gcgctccctg cgccggcctt cttcaccgcg gtcacgcagc 481 tggagccgca cggcctggag ctggccgcgg tgtccaccac tccagagcgg cagaccctcg 541 tgagcctggc tcagcccacg cccaagtacc cccatgaagt gaatgggacc ccaatgtatc 601 tctatgaagt ggccacggag tcggtgtgtg aatcagctgc cagacttctc ttcatgagca 661 tcaagtgggc taagagtgtg ccagccttct ccacgctgtc tttgcaagac cagctgatgc 721 ttttggaaga tgcttggaga gaactgtttg ttctaggaat agcacaatgg gccattccgg 781 ttgatgctaa cactctactg gctgtatctg gcatgaacgg tgacaacaca gattcccaga 841 agctgaacaa gatcatatct gaaatacagg ctttacaaga ggtggtggct cgatttagac 901 aactccggtt agatgctact gaatttgcct gtctaaaatg catcgtcact ttcaaagccg 961 ttcctacaca tagtggttct gaactgagaa gtttccggaa tgctgccgcc attgcagccc 1021 ttcaagatga ggcTCAGCTA ACGCTCAACA GCTACATCCA TACCAGATAT CCCACTCAAC 1081 CCTGTCGCTT TGGAAAACTC CTGTTGCTTT TGCCAGCTTT ACGTTCTATT AGCCCATCAA 1141 CTATAGAAGA AGTGTTTTTC AAAAAAACCA TCGGCAATGT GCCAATTACA AGACTGCTTT 1201 CAGATATGTA CAAATCCAGT GATATCGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1261 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1321 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATGCAAATT 1381 CCCTTCGAAA TACTCGACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1441 aagatt