Transcript: Mouse NM_152229.2

Mus musculus nuclear receptor subfamily 2, group E, member 1 (Nr2e1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Nr2e1 (21907)
Length:
3233
CDS:
683..1840

Additional Resources:

NCBI RefSeq record:
NM_152229.2
NBCI Gene record:
Nr2e1 (21907)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_152229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026009 TGCCGATTACAAGACTACTTT pLKO.1 1791 CDS 100% 5.625 7.875 N Nr2e1 n/a
2 TRCN0000026030 CCGGTTGATGCTAACACTCTA pLKO.1 1388 CDS 100% 4.950 6.930 N Nr2e1 n/a
3 TRCN0000025992 CCAGAAGCTGAACAAGATCAT pLKO.1 1447 CDS 100% 4.950 3.465 N Nr2e1 n/a
4 TRCN0000026019 CGTGGACACAAGGAAGACAAT pLKO.1 1004 CDS 100% 4.950 3.465 N Nr2e1 n/a
5 TRCN0000025980 GCTTCTCTTTATGAGCATCAA pLKO.1 1255 CDS 100% 4.950 3.465 N Nr2e1 n/a
6 TRCN0000021673 GCTAACACTCTACTGGCTGTA pLKO.1 1397 CDS 100% 4.050 2.430 N NR2E1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01680 pDONR223 100% 91.8% 98.9% None (many diffs) n/a
2 ccsbBroad304_01680 pLX_304 0% 91.8% 98.9% V5 (many diffs) n/a
3 TRCN0000474078 TAACCCGGGTCGACAGGCTACGGG pLX_317 38% 91.8% 98.9% V5 (many diffs) n/a
4 TRCN0000489273 ATCGATACCACTCCTTATAGAACA pLX_317 25.9% 91.8% 98.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488848 TGCAAATTCCCTTCGAAATACTCG pLX_317 17.2% 91.7% 98.7% V5 (many diffs) n/a
Download CSV