Transcript: Human NM_001286102.1

Homo sapiens nuclear receptor subfamily 2 group E member 1 (NR2E1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
NR2E1 (7101)
Length:
2631
CDS:
5..1273

Additional Resources:

NCBI RefSeq record:
NM_001286102.1
NBCI Gene record:
NR2E1 (7101)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286102.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417486 CAAAGTTTGGTAACCAAATAT pLKO_005 1642 3UTR 100% 15.000 21.000 N NR2E1 n/a
2 TRCN0000432845 AGCTACATCCATACCAGATAT pLKO_005 1094 CDS 100% 13.200 18.480 N NR2E1 n/a
3 TRCN0000021670 CCATCGGCAATGTGCCAATTA pLKO.1 1212 CDS 100% 13.200 18.480 N NR2E1 n/a
4 TRCN0000428266 TACGTTATGTTGGAGCATTTA pLKO_005 1700 3UTR 100% 13.200 18.480 N NR2E1 n/a
5 TRCN0000021672 CGATTTAGACAACTCCGGTTA pLKO.1 935 CDS 100% 4.050 5.670 N NR2E1 n/a
6 TRCN0000026030 CCGGTTGATGCTAACACTCTA pLKO.1 821 CDS 100% 4.950 3.465 N Nr2e1 n/a
7 TRCN0000021673 GCTAACACTCTACTGGCTGTA pLKO.1 830 CDS 100% 4.050 2.835 N NR2E1 n/a
8 TRCN0000021669 CGGCTGAAGAAGTGTTTGGAA pLKO.1 335 CDS 100% 3.000 2.100 N NR2E1 n/a
9 TRCN0000025992 CCAGAAGCTGAACAAGATCAT pLKO.1 880 CDS 100% 4.950 2.970 N Nr2e1 n/a
10 TRCN0000021671 CCGTTCCTACACATAGTGGTT pLKO.1 1002 CDS 100% 2.640 1.584 N NR2E1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2314 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286102.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01680 pDONR223 100% 90.3% 88.9% None (many diffs) n/a
2 ccsbBroad304_01680 pLX_304 0% 90.3% 88.9% V5 (many diffs) n/a
3 TRCN0000474078 TAACCCGGGTCGACAGGCTACGGG pLX_317 38% 90.3% 88.9% V5 (many diffs) n/a
4 TRCN0000489273 ATCGATACCACTCCTTATAGAACA pLX_317 25.9% 90.3% 88.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488848 TGCAAATTCCCTTCGAAATACTCG pLX_317 17.2% 90.2% 88.7% V5 (many diffs) n/a
Download CSV