Construct: ORF TRCN0000488903
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020419.1_s317c1
- DNA Barcode:
- TTGCCCCAATCACATTTTCGGAAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- AKT2 (208)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488903
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | NM_001626.6 | 99.9% | 100% | 78C>T |
| 2 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526614.1 | 99.9% | 100% | 78C>T |
| 3 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526615.1 | 99.9% | 100% | 78C>T |
| 4 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526616.1 | 99.9% | 100% | 78C>T |
| 5 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526618.1 | 99.9% | 100% | 78C>T |
| 6 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526619.1 | 99.9% | 100% | 78C>T |
| 7 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526620.1 | 99.9% | 100% | 78C>T |
| 8 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_017026470.2 | 99.9% | 100% | 78C>T |
| 9 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_024451416.1 | 99.9% | 100% | 78C>T |
| 10 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | NM_001330511.1 | 90.9% | 91% | 78C>T;829_830ins129 |
| 11 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_024451417.1 | 90.9% | 91% | 78C>T;829_830ins129 |
| 12 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | NM_001243027.3 | 87.1% | 87.1% | 0_1ins186 |
| 13 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | NM_001243028.3 | 87.1% | 87.1% | 0_1ins186 |
| 14 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526622.2 | 82.5% | 81.7% | (many diffs) |
| 15 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | NM_001110208.2 | 90.4% | 98.1% | (many diffs) |
| 16 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | NM_001331108.1 | 90.4% | 98.1% | (many diffs) |
| 17 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | NM_001331109.1 | 90.4% | 98.1% | (many diffs) |
| 18 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | NM_007434.4 | 90.4% | 98.1% | (many diffs) |
| 19 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539477.1 | 90.4% | 98.1% | (many diffs) |
| 20 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539480.1 | 90.4% | 98.1% | (many diffs) |
| 21 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539481.3 | 90.4% | 98.1% | (many diffs) |
| 22 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539482.1 | 82.4% | 89.1% | (many diffs) |
| 23 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539483.1 | 82.4% | 89.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 84
- ORF end:
- 1527
- ORF length:
- 1443
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggctccgc ggcccccttc accatgaatg aggtgtctgt catcaaagaa ggctggctcc 121 acaagcgtgg tgaatacatc aagacctgga ggccacggta tttcctgctg aagagcgacg 181 gctccttcat tgggtacaag gagaggcccg aggcccctga tcagactcta ccccccttaa 241 acaacttctc cgtagcagaa tgccagctga tgaagaccga gaggccgcga cccaacacct 301 ttgtcatacg ctgcctgcag tggaccacag tcatcgagag gaccttccac gtggattctc 361 cagacgagag ggaggagtgg atgcgggcca tccagatggt cgccaacagc ctcaagcagc 421 gggccccagg cgaggacccc atggactaca agtgtggctc ccccagtgac tcctccacga 481 ctgaggagat ggaagtggcg gtcagcaagg cacgggctaa agtgaccatg aatgacttcg 541 actatctcaa actccttggc aagggaacct ttggcaaagt catcctggtg cgggagaagg 601 ccactggccg ctactacgcc atgaagatcc tgcggaagga agtcatcatt gccaaggatg 661 aagtcgctca cacagtcacc gagagccggg tcctccagaa caccaggcac ccgttcctca 721 ctgcgctgaa gtatgccttc cagacccacg accgcctgtg ctttgtgatg gagtatgcca 781 acgggggtga gctgttcttc cacctgtccc gggagcgtgt cttcacagag gagcgggccc 841 ggttttatgg tgcagagatt gtctcggctc ttgagtactt gcactcgcgg gacgtggtat 901 accgcgacat caagctggaa aacctcatgc tggacaaaga tggccacatc aagatcactg 961 actttggcct ctgcaaagag ggcatcagtg acggggccac catgaaaacc ttctgtggga 1021 ccccggagta cctggcgcct gaggtgctgg aggacaatga ctatggccgg gccgtggact 1081 ggtgggggct gggtgtggtc atgtacgaga tgatgtgcgg ccgcctgccc ttctacaacc 1141 aggaccacga gcgcctcttc gagctcatcc tcatggaaga gatccgcttc ccgcgcacgc 1201 tcagccccGA GGCCAAGTCC CTGCTTGCTG GGCTGCTTAA GAAGGACCCC AAGCAGAGGC 1261 TTGGTGGGGG GCCCAGCGAT GCCAAGGAGG TCATGGAGCA CAGGTTCTTC CTCAGCATCA 1321 ACTGGCAGGA CGTGGTCCAG AAGAAGCTCC TGCCACCCTT CAAACCTCAG GTCACGTCCG 1381 AGGTCGACAC AAGGTACTTC GATGATGAAT TTACCGCCCA GTCCATCACA ATCACACCCC 1441 CTGACCGCTA TGACAGCCTG GGCTTACTGG AGCTGGACCA GCGGACCCAC TTCCCCCAGT 1501 TCTCCTACTC GGCCAGCATC CGCGAGTGAT CTAGAAAGGG TGGGCGCGCC GACCCAGCTT 1561 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1621 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1681 CTTGTGGAAA GGACGATTGC CCCAATCACA TTTTCGGAAA ACGCGTTAAG TCgacaatca 1741 acctctggat tacaaaattt gtgaaagatt