Construct: ORF TRCN0000488923
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021814.1_s317c1
- DNA Barcode:
- CAAGAGACGTTTCTCGCTTCGGAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- AKT1 (207)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488923
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 207 | AKT1 | AKT serine/threonine kinase 1 | NM_001014431.2 | 96.9% | 96.9% | (many diffs) |
| 2 | human | 207 | AKT1 | AKT serine/threonine kinase 1 | NM_001014432.1 | 96.9% | 96.9% | (many diffs) |
| 3 | human | 207 | AKT1 | AKT serine/threonine kinase 1 | NM_005163.2 | 96.9% | 96.9% | (many diffs) |
| 4 | human | 207 | AKT1 | AKT serine/threonine kinase 1 | XR_002957536.1 | 33.8% | (many diffs) | |
| 5 | mouse | 11651 | Akt1 | thymoma viral proto-oncogene 1 | NM_001331107.1 | 88% | 95.3% | (many diffs) |
| 6 | mouse | 11651 | Akt1 | thymoma viral proto-oncogene 1 | NM_009652.3 | 88% | 95.3% | (many diffs) |
| 7 | mouse | 11651 | Akt1 | thymoma viral proto-oncogene 1 | XM_006515415.1 | 88% | 95.3% | (many diffs) |
| 8 | mouse | 11651 | Akt1 | thymoma viral proto-oncogene 1 | NM_001165894.1 | 84.9% | 87.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 87
- ORF end:
- 1566
- ORF length:
- 1479
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggctccgc ggccgccccc ttcaccatgg gtagcaacaa gagcaagccc aaggatgcca 121 gccagcggag cgacgtggct attgtgaagg agggttggct gcacaaacga ggggagtaca 181 tcaagacctg gcggccacgc tacttcctcc tcaagaatga tggcaccttc attggctaca 241 aggagcggcc gcaggatgtg gaccaacgtg aggctcccct caacaacttc tctgtggcgc 301 agtgccagct gatgaagacg gagcggcccc ggcccaacac cttcatcatc cgctgcctgc 361 agtggaccac tgtcatcgaa cgcaccttcc atgtggagac tcctgaggag cgggaggagt 421 ggacaaccgc catccagact gtggctgacg gcctcaagaa gcaggaggag gaggagatgg 481 acttccggtc gggctcaccc agtgacaact caggggctga agagatggag gtgtccctgg 541 ccaagcccaa gcaccgcgtg accatgaacg agtttgagta cctgaagctg ctgggcaagg 601 gcactttcgg caaggtgatc ctggtgaagg agaaggccac aggccgctac tacgccatga 661 agatcctcaa gaaggaagtc atcgtggcca aggacgaggt ggcccacaca ctcaccgaga 721 accgcgtctt gcagaactcc aggcacccct tcctcacagc cctgaagtac tctttccaga 781 cccacgaccg cctctgcttt gtcatggagt acgccaacgg gggcgagctg ttcttccacc 841 tgtcccggga gcgtgtgttc tccgaggacc gggcccgctt ctatggcgct gagattgtgt 901 cagccctgga ctacctgcac tcggagaaga acgtggtgta ccgggacctc aagctggaga 961 acctcatgct ggacaaggac gggcacatta agatcacaga cttcgggctg tgcaaggagg 1021 ggatcaagga cggtgccacc atgaagacct tttgcggcac acctgagtac ctggcccccg 1081 aggtgctgga ggacaatgac tacggccgtg cagtggactg gtgggggctg ggcgtggtca 1141 tgtacgagat gatgtgcggt cgcctgccct tctacaacca ggaccatgag aagctttttg 1201 agctcatcct catggaggag atccgcttcc cgcgcacgct tggtcccgag gccaagtcct 1261 tgctttCAGG GCTGCTCAAG AAGGACCCCA AGCAGAGGCT TGGCGGGGGC TCCGAGGACG 1321 CCAAGGAGAT CATGCAGCAT CGCTTCTTTG CCGGTATCGT GTGGCAGCAC GTGTACGAGA 1381 AGAAGCTCAG CCCACCCTTC AAGCCCCAGG TCACGTCGGA GACTGACACC AGGTATTTTG 1441 ATGAGGAGTT CACGGCCCAG ATGATCACCA TCACACCACC TGACCAAGAT GACAGCATGG 1501 AGTGTGTGGA CAGCGAGCGC AGGCCCCACT TCCCCCAGTT CTCCTACTCG GCCAGCAGCA 1561 CGGCCTGATC TAGAAAGGGT GGGCGCGCCG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 1621 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1681 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACAAGA 1741 GACGTTTCTC GCTTCGGAAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1801 tgaaagatt