Construct: ORF TRCN0000489001
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020868.1_s317c1
- DNA Barcode:
- CCTGCGAGCTCTCCATCCGATTCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- P2RY6 (5031)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489001
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277204.1 | 100% | 100% | |
| 2 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277205.1 | 100% | 100% | |
| 3 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277206.1 | 100% | 100% | |
| 4 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277207.1 | 100% | 100% | |
| 5 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_176796.2 | 100% | 100% | |
| 6 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_176797.2 | 100% | 100% | |
| 7 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_176798.2 | 100% | 100% | |
| 8 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_005274022.3 | 100% | 100% | |
| 9 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_006718571.3 | 100% | 100% | |
| 10 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_011545077.2 | 100% | 100% | |
| 11 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_011545079.2 | 100% | 100% | |
| 12 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_011545076.2 | 82.4% | 82.4% | 1_210del |
| 13 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277208.1 | 76.4% | 76.4% | 1_303del |
| 14 | mouse | 233571 | P2ry6 | pyrimidinergic receptor P2Y... | NM_183168.2 | 83.7% | 86.5% | (many diffs) |
| 15 | mouse | 233571 | P2ry6 | pyrimidinergic receptor P2Y... | XM_006507640.3 | 83.7% | 86.5% | (many diffs) |
| 16 | mouse | 233571 | P2ry6 | pyrimidinergic receptor P2Y... | XM_011241739.2 | 83.7% | 86.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1056
- ORF length:
- 984
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggaatgg gacaatggca caggccaggc tctgggcttg ccacccacca 121 cctgtgtcta ccgcgagaac ttcaagcaac tgctgctgcc acctgtgtat tcggcggtgc 181 tggcggctgg cctgccgctg aacatctgtg tcattaccca gatctgcacg tcccgccggg 241 ccctgacccg cacggccgtg tacaccctaa accttgctct ggctgacctg ctatatgcct 301 gctccctgcc cctgctcatc tacaactatg cccaaggtga tcactggccc tttggcgact 361 tcgcctgccg cctggtccgc ttcctcttct atgccaacct gcacggcagc atcctcttcc 421 tcacctgcat cagcttccag cgctacctgg gcatctgcca cccgctggcc ccctggcaca 481 aacgtggggg ccgccgggct gcctggctag tgtgtgtagc cgtgtggctg gccgtgacaa 541 cccagtgcct gcccacagcc atcttcgctg ccacaggcat ccagcgtaac cgcactgtct 601 gctatgacct cagcccgcct gccctggcca cccactatat gccctatggc atggctctca 661 ctgtcatcgg cttcctgctg ccctttgctg ccctgctggc ctgctactgt ctcctggccT 721 GCCGCCTGTG CCGCCAGGAT GGCCCGGCAG AGCCTGTGGC CCAGGAGCGG CGTGGCAAGG 781 CGGCCCGCAT GGCCGTGGTG GTGGCTGCTG CCTTTGCCAT CAGCTTCCTG CCTTTTCACA 841 TCACCAAGAC AGCCTACCTG GCAGTGCGCT CGACGCCGGG CGTCCCCTGC ACTGTATTGG 901 AGGCCTTTGC AGCGGCCTAC AAAGGCACGC GGCCGTTTGC CAGTGCCAAC AGCGTGCTGG 961 ACCCCATCCT CTTCTACTTC ACCCAGAAGA AGTTCCGCCG GCGACCACAT GAGCTCCTAC 1021 AGAAACTCAC AGCCAAATGG CAGAGGCAGG GTCGCTAGGA CCCAGCTTTC TTGTACAAAG 1081 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1141 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1201 ACGACCTGCG AGCTCTCCAT CCGATTCCAC GCGTTAAGTC gacaatcaac ctctggatta 1261 caaaatttgt gaaagatt