Construct: ORF TRCN0000489022
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021702.1_s317c1
- DNA Barcode:
- AGGAAACTGAACGCAAATGATTCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- HNF4G (3174)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489022
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3174 | HNF4G | hepatocyte nuclear factor 4... | NM_001330561.2 | 100% | 100% | |
| 2 | human | 3174 | HNF4G | hepatocyte nuclear factor 4... | XM_017013373.1 | 100% | 100% | |
| 3 | human | 3174 | HNF4G | hepatocyte nuclear factor 4... | XM_017013374.1 | 100% | 100% | |
| 4 | human | 3174 | HNF4G | hepatocyte nuclear factor 4... | XM_017013375.1 | 100% | 100% | |
| 5 | human | 3174 | HNF4G | hepatocyte nuclear factor 4... | XM_017013376.2 | 100% | 100% | |
| 6 | human | 3174 | HNF4G | hepatocyte nuclear factor 4... | NM_004133.5 | 89.6% | 89.6% | 1_141del |
| 7 | mouse | 30942 | Hnf4g | hepatocyte nuclear factor 4... | NM_013920.2 | 84.8% | 93.5% | (many diffs) |
| 8 | mouse | 30942 | Hnf4g | hepatocyte nuclear factor 4... | XM_006530072.3 | 76.8% | 84.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1296
- ORF length:
- 1224
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaatacc acagacaacg gtgtcaactg tctgtgtgct atctgtgggg 121 acagagcaac aggaaaacac tatggggcat ccagctgtga tgggtgcaag ggtttcttca 181 gacgcagcat tcgtaagagt cacgtttatt cttgcaggtt cagtcggcaa tgtgttgttg 241 acaaggacaa aaggaatcaa tgtagatatt gtcgattaag aaagtgtttt agagcgggaa 301 tgaaaaaaga agctgtacaa aatgaacgtg acagaataag caccagaaga agcacatttg 361 atggcagcaa catcccctcc attaacacac tggcacaagc tgaagttcgg tctcgccaga 421 tctcagtctc aagccctggg tcaagcactg acataaacgt taagaaaatt gcaagtattg 481 gtgatgtctg tgaatctatg aaacagcagc tcttagtctt ggtggaatgg gctaaatata 541 ttcctgcctt ctgtgaatta ccattggatg atcaggtggc actgttgaga gctcacgcag 601 gggagcactt actgcttgga gctacaaaga gatccatgat gtataaagat attttgcttt 661 tgggaaacaa ctatgttatt caccgcaaca gctgtgaagt tgagattagc cgtgtggcca 721 atcgtgttct agatgagctg gttagaccat ttcaagaaat ccagattgat gacaatgagt 781 atgcttgttt aaaggcaatt gtattttttg atccagatgc aaaagggcta agcgatccag 841 taaaaattaa gaacatgagg ttccaagtgc agatcggttt ggaggactac atcaatgatc 901 ggcagtatga ctcccggggg aggtttGGAG AGTTGCTTCT GCTCCTGCCC ACACTGCAGA 961 GCATCACGTG GCAAATGATT GAGCAAATAC AGTTTGTTAA ACTTTTTGGG ATGGTTAAAA 1021 TTGACAATCT ACTTCAGGAA ATGCTATTAG GTGGGGCTTC CAATGATGGC AGTCATCTCC 1081 ATCATCCAAT GCATCCACAT TTGTCTCAAG ACCCATTAAC TGGACAAACT ATACTTTTAG 1141 GTCCCATGTC AACACTGGTT CATGCAGACC AGATCTCAAC TCCTGAAACC CCACTCCCTT 1201 CCCCACCACA AGGCTCTGGG CAAGAACAGT ACAAAATAGC TGCAAACCAA GCATCAGTCA 1261 TTTCACACCA GCATCTCTCC AAACAAAAGC AATTGTGAGA CCCAGCTTTC TTGTACAAAG 1321 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1381 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1441 ACGAAGGAAA CTGAACGCAA ATGATTCGAC GCGTTAAGTC gacaatcaac ctctggatta 1501 caaaatttgt gaaagatt