Transcript: Human XM_017013373.1

PREDICTED: Homo sapiens hepatocyte nuclear factor 4 gamma (HNF4G), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HNF4G (3174)
Length:
3205
CDS:
652..1878

Additional Resources:

NCBI RefSeq record:
XM_017013373.1
NBCI Gene record:
HNF4G (3174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013373.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420376 ACATCAATGATCGGCAGTATG pLKO_005 1469 CDS 100% 10.800 7.560 N HNF4G n/a
2 TRCN0000420190 GATGAGCTGGTTAGACCATTT pLKO_005 1312 CDS 100% 10.800 7.560 N HNF4G n/a
3 TRCN0000019243 CACCAGCATCTCTCCAAACAA pLKO.1 1846 CDS 100% 5.625 3.938 N HNF4G n/a
4 TRCN0000019240 CGTGGCAAATGATTGAGCAAA pLKO.1 1547 CDS 100% 4.950 3.465 N HNF4G n/a
5 TRCN0000019241 GAAATCCAGATTGATGACAAT pLKO.1 1336 CDS 100% 4.950 3.465 N HNF4G n/a
6 TRCN0000019239 GCATTCGTAAGAGTCACGTTT pLKO.1 767 CDS 100% 4.950 3.465 N HNF4G n/a
7 TRCN0000019242 GTGACAGAATAAGCACCAGAA pLKO.1 908 CDS 100% 4.050 2.835 N HNF4G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013373.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489022 AGGAAACTGAACGCAAATGATTCG pLX_317 30.5% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000487976 ACCACTAAGGGACAGCAAACCTTC pLX_317 26.2% 99.9% 99.7% V5 (not translated due to prior stop codon) 570G>A n/a
3 TRCN0000489167 TGGGCGGCTTAATGACGTCAGTTT pLX_317 26% 99.8% 99.5% V5 570G>A;1224_1225insG n/a
Download CSV