Transcript: Mouse NM_013920.2

Mus musculus hepatocyte nuclear factor 4, gamma (Hnf4g), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Hnf4g (30942)
Length:
4180
CDS:
300..1556

Additional Resources:

NCBI RefSeq record:
NM_013920.2
NBCI Gene record:
Hnf4g (30942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013920.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026010 GCGACAGAATCAGTACAAGAA pLKO.1 586 CDS 100% 4.950 3.960 N Hnf4g n/a
2 TRCN0000025988 CCCTGTGAAGATTAAGAACAT pLKO.1 1094 CDS 100% 4.950 3.465 N Hnf4g n/a
3 TRCN0000026047 CCTTCTGAATAGCACTGCATA pLKO.1 1567 3UTR 100% 4.950 3.465 N Hnf4g n/a
4 TRCN0000025981 GCTGCCAATGATGGTAGTCAT pLKO.1 1314 CDS 100% 4.950 3.465 N Hnf4g n/a
5 TRCN0000026005 CCCTTCCAAGAGATCCAGATA pLKO.1 1005 CDS 100% 4.950 2.970 N Hnf4g n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013920.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489022 AGGAAACTGAACGCAAATGATTCG pLX_317 30.5% 84.8% 93.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487976 ACCACTAAGGGACAGCAAACCTTC pLX_317 26.2% 84.7% 93.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000489167 TGGGCGGCTTAATGACGTCAGTTT pLX_317 26% 84.7% 93% V5 (many diffs) n/a
Download CSV