Construct: ORF TRCN0000489046
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019105.1_s317c1
- DNA Barcode:
- CGCCTGTCTTGGATCTTGACTATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MPZL2 (10205)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489046
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10205 | MPZL2 | myelin protein zero like 2 | NM_005797.4 | 99.8% | 99.5% | 645_646insG |
| 2 | human | 10205 | MPZL2 | myelin protein zero like 2 | NM_144765.2 | 99.8% | 99.5% | 645_646insG |
| 3 | mouse | 14012 | Mpzl2 | myelin protein zero-like 2 | NM_007962.4 | 84.5% | 81% | (many diffs) |
| 4 | mouse | 14012 | Mpzl2 | myelin protein zero-like 2 | XM_006509999.2 | 84.5% | 81% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 720
- ORF length:
- 648
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtatggc aagagctcta ctcgtgcggt gcttcttctc cttggcatac 121 agctcacagc tctttggcct atagcagctg tggaaattta tacctcccgg gtgctggagg 181 ctgttaatgg gacagatgct cggttaaaat gcactttctc cagctttgcc cctgtgggtg 241 atgctctaac agtgacctgg aattttcgtc ctctagacgg gggacctgag cagtttgtat 301 tctactacca catagatccc ttccaaccca tgagtgggcg gtttaaggac cgggtgtctt 361 gggatgggaa tcctgagcgg tacgatgcct ccatcctTCT CTGGAAACTG CAGTTCGACG 421 ACAATGGGAC ATACACCTGC CAGGTGAAGA ACCCACCTGA TGTTGATGGG GTGATAGGGG 481 AGATCCGGCT CAGCGTCGTG CACACTGTAC GCTTCTCTGA GATCCACTTC CTGGCTCTGG 541 CCATTGGCTC TGCCTGTGCA CTGATGATCA TAATAGTAAT TGTAGTGGTC CTCTTCCAGC 601 ATTACCGGAA AAAGCGATGG GCCGAAAGAG CTCATAAAGT GGTGGAGATA AAATCAAAAG 661 AAGAGGAAAG GCTCAACCAA GAGAAAAAGG TCTCTGTTTA TTTAGAAGAC ACAGACGACC 721 CAGCTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 781 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 841 ATATATCTTG TGGAAAGGAC GACGCCTGTC TTGGATCTTG ACTATCACGC GTTAAGTCga 901 caatcaacct ctggattaca aaatttgtga aagatt