Construct: ORF TRCN0000489088
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019076.1_s317c1
- DNA Barcode:
- TTCTGAAGATACTACTTATTTATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SH2D1A (4068)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489088
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4068 | SH2D1A | SH2 domain containing 1A | NM_002351.4 | 99.7% | 99.2% | 384_385insG |
| 2 | human | 4068 | SH2D1A | SH2 domain containing 1A | NM_001114937.2 | 97.4% | 96.8% | 335_336insAGGTACTAC;375_376insG |
| 3 | mouse | 20400 | Sh2d1a | SH2 domain containing 1A | NM_011364.4 | 84.6% | 86.8% | (many diffs) |
| 4 | mouse | 20400 | Sh2d1a | SH2 domain containing 1A | NM_001313689.1 | 83.1% | 84.4% | (many diffs) |
| 5 | mouse | 20400 | Sh2d1a | SH2 domain containing 1A | NM_001313688.1 | 74.7% | 75.5% | (many diffs) |
| 6 | mouse | 20400 | Sh2d1a | SH2 domain containing 1A | NM_001313691.1 | 54.8% | 51.9% | (many diffs) |
| 7 | mouse | 20400 | Sh2d1a | SH2 domain containing 1A | XM_017318440.1 | 54.8% | 51.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 459
- ORF length:
- 387
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggacgca gtggctgtgt atcatggcaa aatcagcagg gaaaccggcg 121 agaagctcct gcttgccact gggctggatg gcagctattt gctgagggac agcgagagcg 181 tgccaggcgt gtactgccta tgtgtgctgt atcacggtta catttataca taccgagtgt 241 cccagacaga aacaggttct tggagtgctg agacagcACC TGGGGTACAT AAAAGATATT 301 TCCGGAAAAT AAAAAATCTC ATTTCAGCAT TTCAGAAGCC AGATCAAGGC ATTGTAATAC 361 CTCTGCAGTA TCCAGTTGAG AAGAAGTCCT CAGCTAGAAG TACACAAGGT ACTACAGGGA 421 TAAGAGAAGA TCCTGATGTC TGCCTGAAAG CCCCAGACCC AGCTTTCTTG TACAAAGTGG 481 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 541 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 601 ATTCTGAAGA TACTACTTAT TTATTACGCG TTAAGTCgac aatcaacctc tggattacaa 661 aatttgtgaa agatt