Transcript: Human NM_002351.4

Homo sapiens SH2 domain containing 1A (SH2D1A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SH2D1A (4068)
Length:
2523
CDS:
362..748

Additional Resources:

NCBI RefSeq record:
NM_002351.4
NBCI Gene record:
SH2D1A (4068)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002351.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367940 ACAGTTCGGTGAGCTACAAAT pLKO_005 822 3UTR 100% 13.200 18.480 N SH2D1A n/a
2 TRCN0000082709 GCCAGATCAAGGCATTGTAAT pLKO.1 628 CDS 100% 13.200 18.480 N SH2D1A n/a
3 TRCN0000360148 TGCTGTATCACGGTTACATTT pLKO_005 495 CDS 100% 13.200 18.480 N SH2D1A n/a
4 TRCN0000082710 GTGCTGTATCACGGTTACATT pLKO.1 494 CDS 100% 5.625 4.500 N SH2D1A n/a
5 TRCN0000082708 GCAACCTTCTTGCCTAGTGTT pLKO.1 1293 3UTR 100% 4.950 3.960 N SH2D1A n/a
6 TRCN0000082712 CACAAGGTACTACAGGGATAA pLKO.1 693 CDS 100% 10.800 7.560 N SH2D1A n/a
7 TRCN0000360149 GCATCTAGCATGTCGTCAAAG pLKO_005 877 3UTR 100% 10.800 7.560 N SH2D1A n/a
8 TRCN0000081159 CCCAGACAGAAACAGGTTCTT pLKO.1 531 CDS 100% 4.950 3.465 N Sh2d1a n/a
9 TRCN0000082711 GCATTTCAGAAGCCAGATCAA pLKO.1 617 CDS 100% 4.950 3.465 N SH2D1A n/a
10 TRCN0000081160 CCTCTGCAGTATCCAGTTGAA pLKO.1 650 CDS 100% 4.950 3.465 N Sh2d1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002351.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00955 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00955 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475412 GAAGCACCAGATGCTTATTTCACT pLX_317 79.4% 100% 100% V5 n/a
4 TRCN0000489088 TTCTGAAGATACTACTTATTTATT pLX_317 46% 99.7% 99.2% V5 384_385insG n/a
Download CSV