Transcript: Mouse NM_001313691.1

Mus musculus SH2 domain containing 1A (Sh2d1a), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Sh2d1a (20400)
Length:
619
CDS:
25..270

Additional Resources:

NCBI RefSeq record:
NM_001313691.1
NBCI Gene record:
Sh2d1a (20400)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313691.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081158 GCACGACTCTAGTCCTGTAAT pLKO.1 374 3UTR 100% 13.200 18.480 N Sh2d1a n/a
2 TRCN0000081161 CAAGGTTACATCTACACATAT pLKO.1 31 CDS 100% 13.200 10.560 N Sh2d1a n/a
3 TRCN0000081162 ACAGGGAGAAGAGATTCTGAT pLKO.1 229 CDS 100% 4.950 3.465 N Sh2d1a n/a
4 TRCN0000081160 CCTCTGCAGTATCCAGTTGAA pLKO.1 178 CDS 100% 4.950 3.465 N Sh2d1a n/a
5 TRCN0000081159 CCCAGACAGAAACAGGTTCTT pLKO.1 59 CDS 100% 4.950 2.970 N Sh2d1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313691.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00955 pDONR223 100% 54.9% 52.3% None (many diffs) n/a
2 ccsbBroad304_00955 pLX_304 0% 54.9% 52.3% V5 (many diffs) n/a
3 TRCN0000475412 GAAGCACCAGATGCTTATTTCACT pLX_317 79.4% 54.9% 52.3% V5 (many diffs) n/a
4 TRCN0000489088 TTCTGAAGATACTACTTATTTATT pLX_317 46% 54.8% 51.9% V5 (many diffs) n/a
Download CSV