Construct: ORF TRCN0000489105
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021089.1_s317c1
- DNA Barcode:
- CAACGCTGACATACCCGTGCGCGG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- FZD3 (7976)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489105
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7976 | FZD3 | frizzled class receptor 3 | NM_017412.4 | 99.9% | 100% | 435A>G |
| 2 | human | 7976 | FZD3 | frizzled class receptor 3 | NM_145866.1 | 99.9% | 100% | 435A>G |
| 3 | human | 7976 | FZD3 | frizzled class receptor 3 | XM_017013841.1 | 89.8% | 89.9% | 0_1ins201;234A>G |
| 4 | human | 7976 | FZD3 | frizzled class receptor 3 | XM_017013842.1 | 73.1% | 71.1% | (many diffs) |
| 5 | human | 7976 | FZD3 | frizzled class receptor 3 | XM_017013843.1 | 72% | 70.7% | (many diffs) |
| 6 | human | 7976 | FZD3 | frizzled class receptor 3 | XM_017013844.1 | 70.4% | 70.2% | (many diffs) |
| 7 | human | 7976 | FZD3 | frizzled class receptor 3 | XR_001745597.2 | 65.9% | (many diffs) | |
| 8 | human | 7976 | FZD3 | frizzled class receptor 3 | XR_949476.2 | 14.4% | (many diffs) | |
| 9 | mouse | 14365 | Fzd3 | frizzled class receptor 3 | NM_021458.2 | 92.1% | 98.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2070
- ORF length:
- 1998
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggctatg acttggattg tcttctctct ttggcccttg actgtgttca 121 tggggcatat aggtgggcac agtttgtttt cttgtgaacc tattaccttg aggatgtgcc 181 aagatttgcc ttataatact accttcatgc ctaatcttct gaatcattat gaccaacaga 241 cagcagcttt ggcaatggag ccattccacc ctatggtgaa tctggattgt tctcgggatt 301 tccggccttt tctttgtgca ctctacgctc ctatttgtat ggaatatgga cgtgtcacac 361 ttccctgtcg taggctgtgt cagcgggctt acagtgagtg ttcgaagctc atggagatgt 421 ttggtgttcc ttggcctgaa gatatggaat gcagtaggtt cccagattgt gatgagccat 481 atcctcgact tgtggatctg aatttggctg gagaaccaac tgaaggagcc ccagtggcag 541 tgcagagaga ctatggtttt tggtgtcccc gagagttaaa aattgatcct gatctgggtt 601 attcttttct gcatgtgcgt gattgttcac ctccttgtcc aaatatgtac ttcagaagag 661 aagaactgtc atttgctcgc tatttcatag gattgatttc aatcatttgc ctctcggcca 721 cattgtttac ttttttaact tttttgattg atgtcacaag attccgttat cctgaaaggc 781 ctattatatt ttatgcagtc tgctacatga tggtatcctt aattttcttc attggatttt 841 tgcttgaaga tcgagtagcc tgcaatgcat ccatccctgc acaatataag gcttccacag 901 tgacacaagg atctcataat aaagcctgta ccatgctttt tatgatactc tattttttta 961 ctatggctgg cagtgtatgg tgggtaattc ttaccatcac atggttttta gcagctgtgc 1021 caaagtgggg tagtgaagct attgagaaga aagcattgct gtttcacgcc agtgcatggg 1081 gcatccccgg aactctaacc atcatccttt tagcgatgaa taaaattgaa ggtgacaata 1141 ttagtggcgt gtgttttgtt ggcctctacg atgttgatgc attgagatat tttgttcttg 1201 ctcccctctg cctgtatgtg gtagttgggg tttctctcct cttagctggc attatatccc 1261 taaacagagt tcgaattgag attccattag aaaaggagaa ccaagataaa ttagtgaagt 1321 ttatgatccg gatcggtgtt ttcagcattc tttatctcgt accactcttg gttgtaattg 1381 gatgctactt ttatgagcaa gcttaccggg gcatctggga aacaacgtgg atacaagaac 1441 gctgcagaga atatcacatt ccatgtccat atcaggttac tcaaatgagt cgtccagact 1501 tgattctctt tctgatgaaa tacctgatgg ctctcatagt tggcattccc tctgtatttt 1561 gggttggaag caaaaagaca tgctttgaat gggccagttt ttttcatggt cgtaggaaaa 1621 aagagatagt gaatgagagc cgacaggtac tccaggaacc tgattttgct cagtctctcc 1681 tgagggatcc aaatactcct atcataagaa agtcaagggG AACTTCCACT CAAGGAACAT 1741 CCACCCATGC TTCTTCAACT CAGCTGGCTA TGGTGGATGA TCAAAGAAGC AAAGCAGGAA 1801 GCATCCACAG CAAAGTGAGC AGCTACCACG GCAGCCTCCA CAGATCACGT GATGGCAGGT 1861 ACACGCCCTG CAGTTACAGA GGAATGGAGG AGAGACTACC TCATGGCAGC ATGTCACGAC 1921 TAACAGATCA CTCCAGGCAT AGTAGTTCTC ATCGGCTCAA TGAACAGTCA CGACATAGCA 1981 GCATCAGAGA TCTCAGTAAT AATCCCATGA CTCATATCAC ACATGGCACC AGCATGAATC 2041 GGGTTATTGA AGAAGATGGA ACCAGTGCTT AAGACCCAGC TTTCTTGTAC AAAGTGGTTG 2101 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 2161 GTCCGTAACT TGAATATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACAAC 2221 GCTGACATAC CCGTGCGCGG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt 2281 gtgaaagatt