Transcript: Human XM_017013843.1

PREDICTED: Homo sapiens frizzled class receptor 3 (FZD3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FZD3 (7976)
Length:
2081
CDS:
520..1995

Additional Resources:

NCBI RefSeq record:
XM_017013843.1
NBCI Gene record:
FZD3 (7976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013843.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363128 GTGCACTCTACGCTCCTATTT pLKO_005 764 CDS 100% 13.200 18.480 N FZD3 n/a
2 TRCN0000008326 CGCTCCTATTTGTATGGAATA pLKO.1 774 CDS 100% 10.800 15.120 N FZD3 n/a
3 TRCN0000008327 CCTCGACTTGTGGATCTGAAT pLKO.1 931 CDS 100% 4.950 6.930 N FZD3 n/a
4 TRCN0000363091 ATCCTGAAAGGCCTATTATAT pLKO_005 1217 CDS 100% 15.000 12.000 N FZD3 n/a
5 TRCN0000008328 GCCTAATCTTCTGAATCATTA pLKO.1 657 CDS 100% 13.200 10.560 N FZD3 n/a
6 TRCN0000363100 ACTGTCATTTGCTCGCTATTT pLKO_005 1113 CDS 100% 13.200 9.240 N FZD3 n/a
7 TRCN0000008325 GCAGAGAATATCACATTCCAT pLKO.1 1892 CDS 100% 3.000 2.100 N FZD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013843.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489105 CAACGCTGACATACCCGTGCGCGG pLX_317 17.9% 72% 70.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV