Construct: ORF TRCN0000489160
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020378.1_s317c1
- DNA Barcode:
- GAATCAGTCCCATGATTCGAGTGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CAMK1 (8536)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489160
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | NM_003656.5 | 100% | 100% | |
| 2 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XM_005265516.2 | 89.5% | 84.7% | 1030_1136del;1218_1239del |
| 3 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XM_017007354.1 | 88.1% | 88.1% | 83_84ins132 |
| 4 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XM_024453796.1 | 83.2% | 83.2% | 0_1ins186 |
| 5 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XM_005265517.3 | 78.9% | 74% | 83_84ins132;898_1004del;1086_1107del |
| 6 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XR_940505.2 | 68.9% | 1_139del;771_772ins113;1137_1333del | |
| 7 | mouse | 52163 | Camk1 | calcium/calmodulin-dependen... | NM_133926.2 | 89.8% | 95.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1182
- ORF length:
- 1110
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgctgggg gcagtggaag gccccaggtg gaagcaggcg gaggacatta 121 gagacatcta cgacttccga gatgttctgg gcacgggggc cttctcggag gtgatcctgg 181 cagaagataa gaggacgcag aagctggtgg ccatcaaatg cattgccaag gaggccctgg 241 agggcaagga aggcagcatg gagaatgaga ttgctgtcct gcacaagatc aagcacccca 301 acattgtagc cctggatgac atctatgaga gtgggggcca cctctacctc atcatgcagc 361 tggtgtcggg tggggagctc tttgaccgta ttgtggaaaa aggcttctac acggagcggg 421 acgccagccg cctcatcttc caggtgctgg atgctgtgaa atacctgcat gacctgggca 481 ttgtacaccg ggatctcaag ccagagaatc tgctgtacta cagcctggat gaagactcca 541 aaatcatgat ctccgacttt ggcctctcca agatggagga cccgggcagt gtgctctcca 601 ccgcctgtgg aactccggga tacgtggccc ctgaagtcct ggcccagaag ccctacagca 661 aggctgtgga ttgctggtcc ataggtgtca tcgcctacat cttgctctgc ggttaccctc 721 ccttctatga cgagaatgat gccaaactct ttgaacagat tttgaaggcc gagtacgagt 781 ttgactctcc ttactgggac gacatctctg actctgccaa agatttcatc cggcacttga 841 tgGAGAAGGA CCCAGAGAAA AGATTCACCT GTGAGCAGGC CTTGCAGCAC CCATGGATTG 901 CAGGAGATAC AGCTCTAGAT AAGAATATCC ACCAGTCGGT GAGTGAGCAG ATCAAGAAGA 961 ACTTTGCCAA GAGCAAGTGG AAGCAAGCCT TCAATGCCAC GGCTGTGGTG CGGCACATGA 1021 GGAAACTGCA GCTGGGCACC AGCCAGGAGG GGCAGGGGCA GACGGCGAGC CATGGGGAGC 1081 TGCTGACACC AGTGGCTGGG GGGCCGGCAG CTGGCTGTTG CTGTCGAGAC TGCTGCGTGG 1141 AGCCGGGCAC AGAACTGTCC CCCACACTGC CCCACCAGCT CTAGGACCCA GCTTTCTTGT 1201 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1261 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1321 GAAAGGACGA GAATCAGTCC CATGATTCGA GTGCACGCGT TAAGTCgaca atcaacctct 1381 ggattacaaa atttgtgaaa gatt