Construct: ORF TRCN0000489217
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021010.1_s317c1
- DNA Barcode:
- CCCCCCTGAAGTTTGTATTGCCAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- VIPR1 (7433)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489217
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_004624.4 | 99.7% | 99.7% | 444T>C;1022G>T;1356C>A |
| 2 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_005265437.2 | 99.5% | 99.5% | (many diffs) |
| 3 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_001251885.1 | 93.8% | 93.2% | (many diffs) |
| 4 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_001251882.1 | 90.8% | 90.8% | (many diffs) |
| 5 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_005265438.3 | 90.8% | 90.8% | (many diffs) |
| 6 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_011534079.1 | 90.8% | 90.8% | (many diffs) |
| 7 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_005265439.2 | 89.4% | 86.6% | (many diffs) |
| 8 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_001251884.1 | 89.2% | 86.4% | (many diffs) |
| 9 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_011534080.2 | 75.6% | 71.9% | (many diffs) |
| 10 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_001251883.1 | 53.3% | 39.6% | (many diffs) |
| 11 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XR_001740254.1 | 48.6% | (many diffs) | |
| 12 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XR_940500.2 | 48.1% | (many diffs) | |
| 13 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XR_001740255.1 | 39.6% | (many diffs) | |
| 14 | mouse | 22354 | Vipr1 | vasoactive intestinal pepti... | XM_006512068.3 | 85.8% | 84.4% | (many diffs) |
| 15 | mouse | 22354 | Vipr1 | vasoactive intestinal pepti... | NM_011703.4 | 85.7% | 84.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1443
- ORF length:
- 1371
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcgcccg ccaagtccgc tgcccgcccg ctggctatgc gtgctggcag 121 gcgccctcgc ctgggccctt gggccggcgg gcggccaggc ggccaggctg caggaggagt 181 gtgactatgt gcagatgatc gaggtgcagc acaagcagtg cctggaggag gcccagctgg 241 agaatgagac aataggctgc agcaagatgt gggacaacct cacctgctgg ccagccaccc 301 ctcggggcca ggtagttgtc ttggcctgtc ccctcatctt caagctcttc tcctccattc 361 aaggccgcaa tgtaagccgc agctgcaccg acgaaggctg gacgcacctg gagcctggcc 421 cgtaccccat tgcctgtggt ttggatgaca aggcagcgag tttggatgag cagcagacca 481 tgttctacgg ttctgtgaag accggctaca ccatcggcta cggcctgtcc ctcgccaccc 541 ttctggtcgc cacagctatc ctgagcctgt tcaggaagct ccactgcacg cggaactaca 601 tccacatgca cctcttcata tccttcatcc tgagggctgc cgctgtcttc atcaaagact 661 tggccctctt cgacagcggg gagtcggacc agtgctccga gggctcggtg ggctgtaagg 721 cagccatggt ctttttccaa tattgtgtca tggctaactt cttctggctg ctggtggagg 781 gcctctacct gtacaccctg cttgccgtct ccttcttctc tgagcggaag tacttctggg 841 ggtacatact catcggctgg ggggtaccca gcacattcac catggtgtgg accatcgcca 901 ggatccattt tgaggattat gggtgctggg acaccatcaa ctcctcactg tggtggatca 961 taaagggccc catcctcacc tccatcttgg taaacttcat cctgtttatt tgcatcatcc 1021 gaatcctgct tcagaaactg cggcccccag atatcaggaa gagtgacagc agtccatact 1081 caaggctagc catgtccaca ctccTGCTGA TCCCCCTGTT TGGAGTACAC TACATCATGT 1141 TCGCCTTCTT TCCGGACAAT TTTAAGCCTG AAGTGAAGAT GGTCTTTGAG CTCGTCGTGG 1201 GGTCTTTCCA GGGTTTTGTG GTGGCTATCC TCTACTGCTT CCTCAATGGT GAGGTGCAGG 1261 CGGAGCTGAG GCGGAAGTGG CGGCGCTGGC ACCTGCAGGG CGTCCTGGGC TGGAACCCCA 1321 AATACCGGCA CCCGTCGGGA GGCAGCAACG GCGCCACGTG CAGCACGCAG GTTTCCATGC 1381 TGACCCGCGT CAGCCCAGGT GCCCGCCGCT CCTCCAGCTT CCAAGCAGAA GTCTCCCTGG 1441 TCTGAGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1501 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1561 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACCCCCCTGA AGTTTGTATT GCCACACGCG 1621 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt