Construct: ORF TRCN0000489264
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF022019.1_s317c1
- DNA Barcode:
- CATACTGTGCAGTTTTTCGAACGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- TEX264 (51368)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489264
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NM_001129884.2 | 100% | 100% | |
| 2 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NM_001243725.2 | 100% | 100% | |
| 3 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NM_001243726.2 | 100% | 100% | |
| 4 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NM_001278195.1 | 100% | 100% | |
| 5 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NM_015926.6 | 100% | 100% | |
| 6 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | XM_006713195.3 | 100% | 100% | |
| 7 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | XM_006713197.4 | 100% | 100% | |
| 8 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | XM_011533805.2 | 100% | 100% | |
| 9 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NM_001243727.2 | 76.3% | 76.3% | 257_258ins222 |
| 10 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | XM_006713198.2 | 76.1% | 73.8% | (many diffs) |
| 11 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NR_103462.1 | 57.8% | (many diffs) | |
| 12 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NR_024012.3 | 56.6% | (many diffs) | |
| 13 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NR_103463.1 | 56.2% | (many diffs) | |
| 14 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | XM_017006574.2 | 55.4% | 52.7% | (many diffs) |
| 15 | human | 100996349 | LOC100996349 | testis expressed 264, ER-ph... | NR_103470.1 | 13.9% | (many diffs) | |
| 16 | mouse | 21767 | Tex264 | testis expressed gene 264 | NM_001081654.2 | 85% | 83% | (many diffs) |
| 17 | mouse | 21767 | Tex264 | testis expressed gene 264 | NM_001286498.1 | 85% | 83% | (many diffs) |
| 18 | mouse | 21767 | Tex264 | testis expressed gene 264 | NM_011573.3 | 85% | 83% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1008
- ORF length:
- 939
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gtcggacctg ctactactgg gcctgattgg gggcctgact ctcttactgc 121 tgctgacgct gctggccttt gccgggtact cagggctact ggctggggtg gaagtgagtg 181 ctgggtcacc ccccatccgc aacgtcactg tggcctacaa gttccacatg gggctctatg 241 gtgagactgg gcggcttttc actgagagct gcagcatctc tcccaagctc cgctccatcg 301 ctgtctacta tgacaacccc cacatggtgc cccctgataa gtgccgatgt gccgtgggca 361 gcatcctgag tgaaggtgag gaatcgccct cccctgagct catcgacctc taccagaaat 421 ttggcttcaa ggtgttctcc ttcccggcac ccagccatgt ggtgacagcc accttcccct 481 acaccaccat tctgtccatc tggctggcta cccgccgtgt ccatcctgcc ttggacacct 541 acatcaagga gcggaagctg tgtgcctatc ctcggctgga gatctaccag gaagaccaga 601 tccatttcat gtgcccactg gcacggcagg gagacttcta tgtgccTGAG ATGAAGGAGA 661 CAGAGTGGAA ATGGCGGGGG CTTGTGGAGG CCATTGACAC CCAGGTGGAT GGCACAGGAG 721 CTGACACAAT GAGTGACACG AGTTCTGTAA GCTTGGAAGT GAGCCCTGGC AGCCGGGAGA 781 CTTCAGCTGC CACACTGTCA CCTGGGGCGA GCAGCCGTGG CTGGGATGAC GGTGACACCC 841 GCAGCGAGCA CAGCTACAGC GAGTCAGGTG CCAGCGGCTC CTCTTTTGAG GAGCTGGACT 901 TGGAGGGCGA GGGGCCCTTA GGGGAGTCAC GGCTGGACCC TGGGACTGAG CCCCTGGGGA 961 CTACCAAGTG GCTCTGGGAG CCCACTGCCC CTGAGAAGGG CAAGGAGTAA GACCCAGCTT 1021 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1081 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1141 CTTGTGGAAA GGACGACATA CTGTGCAGTT TTTCGAACGA ACGCGTTAAG TCgacaatca 1201 acctctggat tacaaaattt gtgaaagatt