Construct: ORF TRCN0000489283
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020884.1_s317c1
- DNA Barcode:
- TCAGCCCCCGCTATGCCTTCAGGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR63 (81491)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489283
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 81491 | GPR63 | G protein-coupled receptor 63 | NM_001143957.3 | 100% | 100% | |
| 2 | human | 81491 | GPR63 | G protein-coupled receptor 63 | NM_030784.4 | 100% | 100% | |
| 3 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_006715570.4 | 100% | 100% | |
| 4 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536153.2 | 100% | 100% | |
| 5 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536154.2 | 100% | 100% | |
| 6 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536155.2 | 100% | 100% | |
| 7 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536157.2 | 100% | 100% | |
| 8 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536159.2 | 100% | 100% | |
| 9 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_017011334.1 | 100% | 100% | |
| 10 | mouse | 81006 | Gpr63 | G protein-coupled receptor 63 | NM_030733.3 | 86.3% | 91% | (many diffs) |
| 11 | mouse | 81006 | Gpr63 | G protein-coupled receptor 63 | XM_006538382.3 | 86.3% | 91% | (many diffs) |
| 12 | mouse | 81006 | Gpr63 | G protein-coupled receptor 63 | XM_006538383.3 | 86.3% | 91% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1329
- ORF length:
- 1257
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggtcttc tcggcagtgt tgactgcgtt ccataccggg acatccaaca 121 caacatttgt cgtgtatgaa aacacctaca tgaatattac actccctcca ccattccagc 181 atcctgacct cagtccattg cttagatata gttttgaaac catggctccc actggtttga 241 gttccttgac cgtgaatagt acagctgtgc ccacaacacc agcagcattt aagagcctaa 301 acttgcctct tcagatcacc ctttctgcta taatgatatt cattctgttt gtgtcttttc 361 ttgggaactt ggttgtttgc ctcatggttt accaaaaagc tgccatgagg tctgcaatta 421 acatcctcct tgccagccta gcttttgcag acatgttgct tgcagtgctg aacatgccct 481 ttgccctggt aactattctt actacccgat ggatttttgg gaaattcttc tgtagggtat 541 ctgctatgtt tttctggtta tttgtgatag aaggagtagc catcctgctc atcattagca 601 tagataggtt ccttattata gtccagaggc aggataagct aaacccatat agagctaagg 661 ttctgattgc agtttcttgg gcaacttcct tttgtgtagc ttttccttta gccgtaggaa 721 accccgacct gcagatacct tcccgagctc cccagtgtgt gtttgggtac acaaccaatc 781 caggctacca ggcttatgtg attttgattt ctctcatttc tttcttcata cccttcctgg 841 taatactgta ctcatttatg ggcatactca acacccttcg gcacaatgcc ttgaggatcc 901 atagctaccc tgaaggtata tgcctcagcc aggccagcaa actgggTCTC ATGAGTCTGC 961 AGAGACCTTT CCAGATGAGC ATTGACATGG GCTTTAAAAC ACGTGCCTTC ACCACTATTT 1021 TGATTCTCTT TGCTGTCTTC ATTGTCTGCT GGGCCCCATT CACCACTTAC AGCCTTGTGG 1081 CAACATTCAG TAAGCACTTT TACTATCAGC ACAACTTTTT TGAGATTAGC ACCTGGCTAC 1141 TGTGGCTCTG CTACCTCAAG TCTGCATTGA ATCCGCTGAT CTACTACTGG AGGATTAAGA 1201 AATTCCATGA TGCTTGCCTG GACATGATGC CTAAGTCCTT CAAGTTTTTG CCGCAGCTCC 1261 CTGGTCACAC AAAGCGACGG ATACGTCCTA GTGCTGTCTA TGTGTGTGGG GAACATCGGA 1321 CGGTGGTGTA GGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1381 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1441 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATCA GCCCCCGCTA TGCCTTCAGG 1501 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t