Construct: ORF TRCN0000489321
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020812.1_s317c1
- DNA Barcode:
- AACCTCTGCTACATCAAACACCTG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- ADORA2B (136)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489321
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 136 | ADORA2B | adenosine A2b receptor | NM_000676.2 | 100% | 100% | |
| 2 | human | 136 | ADORA2B | adenosine A2b receptor | XM_011523659.3 | 67.9% | 67.1% | (many diffs) |
| 3 | human | 136 | ADORA2B | adenosine A2b receptor | XM_017024197.2 | 67.9% | 66.2% | (many diffs) |
| 4 | human | 136 | ADORA2B | adenosine A2b receptor | XR_001752428.1 | 43.1% | 1_523del;858_1237del;1900_2306del | |
| 5 | human | 136 | ADORA2B | adenosine A2b receptor | XM_011523661.2 | 34.3% | 33.7% | (many diffs) |
| 6 | mouse | 11541 | Adora2b | adenosine A2b receptor | NM_007413.4 | 87.4% | 87.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1068
- ORF length:
- 996
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgctgctg gagacacagg acgcgctgta cgtggcgctg gagctggtca 121 tcgccgcgct ttcggtggcg ggcaacgtgc tggtgtgcgc cgcggtgggc acggcgaaca 181 ctctgcagac gcccaccaac tacttcctgg tgtccctggc tgcggccgac gtggccgtgg 241 ggctcttcgc catccccttt gccatcacca tcagcctggg cttctgcact gacttctacg 301 gctgcctctt cctcgcctgc ttcgtgctgg tgctcacgca gagctccatc ttcagccttc 361 tggccgtggc agtcgacaga tacctggcca tctgtgtccc gctcaggtat aaaagtttgg 421 tcacggggac ccgagcaaga ggggtcattg ctgtcctctg ggtccttgcc tttggcatcg 481 gattgactcc attcctgggg tggaacagta aagacagtgc caccaacaac tgcacagaac 541 cctgggatgg aaccacgaat gaaagctgct gccttgtgaa gtgtctcttt gagaatgtgg 601 tccccatgag ctacatggta tatttcaatt tctttgggtg tgttctgccc ccactgctta 661 taatgctggt gatctaCATT AAGATCTTCC TGGTGGCCTG CAGGCAGCTT CAGCGCACTG 721 AGCTGATGGA CCACTCGAGG ACCACCCTCC AGCGGGAGAT CCATGCAGCC AAGTCACTGG 781 CCATGATTGT GGGGATTTTT GCCCTGTGCT GGTTACCTGT GCATGCTGTT AACTGTGTCA 841 CTCTTTTCCA GCCAGCTCAG GGTAAAAATA AGCCCAAGTG GGCAATGAAT ATGGCCATTC 901 TTCTGTCACA TGCCAATTCA GTTGTCAATC CCATTGTCTA TGCTTACCGG AACCGAGACT 961 TCCGCTACAC TTTTCACAAA ATTATCTCCA GGTATCTTCT CTGCCAAGCA GATGTCAAGA 1021 GTGGGAATGG TCAGGCTGGG GTACAGCCTG CTCTCGGTGT GGGCCTATAG GACCCAGCTT 1081 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1141 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1201 CTTGTGGAAA GGACGAAACC TCTGCTACAT CAAACACCTG ACGCGTTAAG TCgacaatca 1261 acctctggat tacaaaattt gtgaaagatt