Construct: ORF TRCN0000489342
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019403.1_s317c1
- DNA Barcode:
- TGTCCTAGTTTAGGCCCAGTAGTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NPY1R (4886)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489342
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4886 | NPY1R | neuropeptide Y receptor Y1 | NM_000909.6 | 99.8% | 99.7% | 75T>C;1152_1153insG |
| 2 | human | 4886 | NPY1R | neuropeptide Y receptor Y1 | XM_005263031.4 | 99.8% | 99.7% | 75T>C;1152_1153insG |
| 3 | human | 4886 | NPY1R | neuropeptide Y receptor Y1 | XM_011532010.3 | 99.8% | 99.7% | 75T>C;1152_1153insG |
| 4 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | NM_010934.4 | 84.9% | 93.2% | (many diffs) |
| 5 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | XM_006509594.3 | 84.9% | 93.2% | (many diffs) |
| 6 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | XM_006509595.3 | 84.9% | 93.2% | (many diffs) |
| 7 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | XM_006509596.3 | 84.9% | 93.2% | (many diffs) |
| 8 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | XM_017312614.1 | 84.9% | 93.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1230
- ORF length:
- 1155
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgaat tcaacattat tttcccaggt tgaaaatcat tcagtccact 121 ctaatttctc agagaagaat gcccagctcc tggcttttga aaatgatgat tgtcatctgc 181 ccttggccat gatatttacc ttagctcttg cttatggagc tgtgatcatt cttggtgtct 241 ctggaaacct ggccttgatc ataatcatct tgaaacaaaa ggagatgaga aatgttacca 301 acatcctgat tgtgaacctt tccttctcag acttgcttgt tgccatcatg tgtctcccct 361 ttacatttgt ctacacatta atggaccact gggtctttgg tgaggcgatg tgtaagttga 421 atccttttgt gcaatgtgtt tcaatcactg tgtccatttt ctctctggtt ctcattgctg 481 tggaacgaca tcagctgata atcaaccctc gagggtggag accaaataat agacatgctt 541 atgtaggtat tgctgtgatt tgggtccttg ctgtggcttc ttctttgcct ttcctgatct 601 accaagtaat gactgatgag ccgttccaaa atgtaacact tgatgcgtac aaagacaaat 661 acgtgtgctt tgatcaattt ccatcggact ctcataggtt gtcttatacc actctcctct 721 tggtgctgca gtattttggt ccactttgtt ttatatttat ttgctacttc aagatatata 781 tacgcctaaa aaggagaaac aacatgatgg acaagatgag agacaataag tacaggtcca 841 gtgaaaccaa aagaatcaat atcatgctgc tctccattgt ggtagcattt gcagtctgct 901 ggctccctct taccatcttt aacactgtgt ttgattggaa tcatcagatc attgctacct 961 gcaaccacaa tctgttattc cTGCTCTGCC ACCTCACAGC AATGATATCC ACTTGTGTCA 1021 ACCCCATATT TTATGGGTTC CTGAACAAAA ACTTCCAGAG AGACTTGCAG TTCTTCTTCA 1081 ACTTTTGTGA TTTCCGGTCT CGGGATGATG ATTATGAAAC AATAGCCATG TCCACGATGC 1141 ACACAGATGT TTCCAAAACT TCTTTGAAGC AAGCAAGCCC AGTCGCATTT AAAAAAATCA 1201 ACAACAATGA TGATAATGAA AAAATCGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1261 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1321 AACTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG ATGTCCTAGT 1381 TTAGGCCCAG TAGTAACGCG TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa 1441 agatt