Construct: ORF TRCN0000489343
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019468.1_s317c1
- DNA Barcode:
- CCAAATCTATTTCTGTATCAGGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- P2RY2 (5029)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489343
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | NM_002564.4 | 99.7% | 99.4% | 137C>T;816C>T;1131_1132insG |
| 2 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | NM_176071.3 | 99.7% | 99.4% | 137C>T;816C>T;1131_1132insG |
| 3 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | NM_176072.3 | 99.7% | 99.4% | 137C>T;816C>T;1131_1132insG |
| 4 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_005274019.4 | 99.7% | 99.4% | 137C>T;816C>T;1131_1132insG |
| 5 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_005274020.4 | 99.7% | 99.4% | 137C>T;816C>T;1131_1132insG |
| 6 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_005274021.4 | 99.7% | 99.4% | 137C>T;816C>T;1131_1132insG |
| 7 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_011545074.2 | 99.7% | 99.4% | 137C>T;816C>T;1131_1132insG |
| 8 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_017017839.1 | 99.7% | 99.4% | 137C>T;816C>T;1131_1132insG |
| 9 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XR_001747891.1 | 53.8% | (many diffs) | |
| 10 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XR_001747890.1 | 46% | (many diffs) | |
| 11 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XR_001747892.1 | 34.9% | (many diffs) | |
| 12 | mouse | 18442 | P2ry2 | purinergic receptor P2Y, G-... | NM_001302346.1 | 84.5% | 89.4% | (many diffs) |
| 13 | mouse | 18442 | P2ry2 | purinergic receptor P2Y, G-... | NM_001302347.1 | 84.5% | 89.4% | (many diffs) |
| 14 | mouse | 18442 | P2ry2 | purinergic receptor P2Y, G-... | NM_008773.4 | 84.5% | 89.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1209
- ORF length:
- 1134
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggca gcagacctgg gcccctggaa tgacaccatc aatggcacct 121 gggatgggga tgagctgggc tacaggtgcc gcttcaacga ggacttcaag tacgtgctgc 181 tgcctgtgtc ctacggcgtg gtgtgcgtgc ttgggctgtg tctgaacgcc gtggcgctct 241 acatcttctt gtgccgcctc aagacctgga atgcgtccac cacatatatg ttccacctgg 301 ctgtgtctga tgcactgtat gcggcctccc tgccgctgct ggtctattac tacgcccgcg 361 gcgaccactg gcccttcagc acggtgctct gcaagctggt gcgcttcctc ttctacacca 421 acctttactg cagcatcctc ttcctcacct gcatcagcgt gcaccggtgt ctgggcgtct 481 tacgacctct gcgctccctg cgctggggcc gggcccgcta cgctcgccgg gtggccgggg 541 ccgtgtgggt gttggtgctg gcctgccagg cccccgtgct ctactttgtc accaccagcg 601 cgcgcggggg ccgcgtaacc tgccacgaca cctcggcacc cgagctcttc agccgcttcg 661 tggcctacag ctcagtcatg ctgggcctgc tcttcgcggt gccctttgcc gtcatccttg 721 tctgttacgt gctcatggct cggcgactgc taaagccagc ctacgggacc tcgggcggcc 781 tgcctagggc caagcgcaag tccgtgcgca ccatcgccgt ggtgctggct gtcttcgccc 841 tctgcttcct gccattccac gtcacccgca ccctctacta ctccttccgt tcgctggacc 901 TCAGCTGCCA CACCCTCAAC GCCATCAACA TGGCCTACAA GGTTACCCGG CCGCTGGCCA 961 GTGCTAACAG TTGCCTTGAC CCCGTGCTCT ACTTCCTGGC TGGGCAGAGG CTCGTACGCT 1021 TTGCCCGAGA TGCCAAGCCA CCCACTGGCC CCAGCCCTGC CACCCCGGCT CGCCGCAGGC 1081 TGGGCCTGCG CAGATCCGAC AGAACTGACA TGCAGAGGAT AGAAGATGTG TTGGGCAGCA 1141 GTGAGGACTC TAGGCGGACA GAGTCCACGC CGGCTGGTAG CGAGAACACT AAGGACATTC 1201 GGCTGGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1261 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1321 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACCAAATCTA TTTCTGTATC AGGACACGCG 1381 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt