Construct: ORF TRCN0000489387
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021052.1_s317c1
- DNA Barcode:
- ACTCAATCACTTTAGCCTGAGGAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR26 (2849)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489387
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2849 | GPR26 | G protein-coupled receptor 26 | NM_153442.4 | 99.8% | 100% | 489A>G;642G>C |
| 2 | mouse | 233919 | Gpr26 | G protein-coupled receptor 26 | NM_173410.3 | 91.4% | 95.2% | (many diffs) |
| 3 | mouse | 233919 | Gpr26 | G protein-coupled receptor 26 | XM_006507766.3 | 71.9% | 75% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1083
- ORF length:
- 1011
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaactcg tgggacgcgg gcctggcggg gctactggtg ggcacgatgg 121 gcgtctcgct gctgtccaac gcgctggtgc tgctctgcct gctgcacagc gcggacatcc 181 gccgccaggc gccggcgctc ttcaccctga acctcacgtg cgggaacctg ctgtgcaccg 241 tggtcaacat gccgctcacg ctggccggcg tcgtggcgca gcggcagccg gcgggcgacc 301 gcctgtgccg cctggctgcc ttcctcgaca ccttcctggc tgccaactcc atgctcagca 361 tggccgcgct cagcatcgac cgctgggtgg ccgtggtctt cccgctgagc taccgggcca 421 agatgcgcct ccgcgacgcg gcgctcatgg tggcctacac gtggctgcac gcgctcacct 481 tcccagccgc cgcgctcgcc ctgtcctggc tcggcttcca ccagctgtac gcctcgtgca 541 cgctgtgcag ccggcggccg gacgagcgcc tgcgcttcgc cgtcttcact ggcgccttcc 601 acgctctcag cttcctgctc tccttcgtcg tgctctgctg cacgtacctc aaggtgctca 661 aggtggcccg cttccattgc aagcgcatcg acgtgatcac catgcagacg ctcgtgctgc 721 tggtggaccT GCACCCCAGT GTGCGGGAAC GCTGTCTGGA GGAGCAGAAG CGGAGGCGAC 781 AGCGAGCCAC CAAGAAGATC AGCACCTTCA TAGGGACCTT CCTTGTGTGC TTCGCGCCCT 841 ATGTGATCAC CAGGCTAGTG GAGCTCTTCT CCACGGTGCC CATCGGCTCC CACTGGGGGG 901 TGCTGTCCAA GTGCTTGGCG TACAGCAAGG CCGCATCCGA CCCCTTTGTG TACTCCTTAC 961 TGCGACACCA GTACCGCAAA AGCTGCAAGG AGATTCTGAA CAGGCTCCTG CACAGACGCT 1021 CCATCCACTC CTCTGGCCTC ACAGGCGACT CTCACAGCCA GAACATTCTG CCGGTGTCTG 1081 AGTGAGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1141 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1201 CTTGGCTTTA TATATCTTGT GGAAAGGACG AACTCAATCA CTTTAGCCTG AGGAAACGCG 1261 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt