Construct: ORF TRCN0000489413
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019649.1_s317c1
- DNA Barcode:
- CCAATTGAGACCTTTACGATGCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RXRA (6256)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489413
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 6256 | RXRA | retinoid X receptor alpha | NM_002957.6 | 99.9% | 99.7% | 1386_1387insG |
2 | human | 6256 | RXRA | retinoid X receptor alpha | NM_001291920.1 | 94% | 93.9% | 0_1ins81;1305_1306insG |
3 | human | 6256 | RXRA | retinoid X receptor alpha | NM_001291921.2 | 78.9% | 78.8% | 0_1ins291;1095_1096insG |
4 | mouse | 20181 | Rxra | retinoid X receptor alpha | NM_011305.3 | 88% | 97.2% | (many diffs) |
5 | mouse | 20181 | Rxra | retinoid X receptor alpha | NM_001290481.1 | 82.9% | 91.8% | (many diffs) |
6 | mouse | 20181 | Rxra | retinoid X receptor alpha | NM_001290482.1 | 82.9% | 91.8% | (many diffs) |
7 | mouse | 20181 | Rxra | retinoid X receptor alpha | XM_006497805.1 | 82.9% | 91.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1455
- ORF length:
- 1389
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaagaat 61 tcaccatgga caccaaacat ttcctgccgc tcgatttctc cacccaggtg aactcctccc 121 tcacctcccc gacggggcga ggctccatgg ctgccccctc gctgcacccg tccctggggc 181 ctggcatcgg ctccccggga cagctgcatt ctcccatcag caccctgagc tcccccatca 241 acggcatggg cccgcctttc tcggtcatca gctcccccat gggcccccac tccatgtcgg 301 tgcccaccac acccaccctg ggcttcagca ctggcagccc ccagctcagc tcacctatga 361 accccgtcag cagcagcgag gacatcaagc cccccctggg cctcaatggc gtcctcaagg 421 tccccgccca cccctcagga aacatggctt ccttcaccaa gcacatctgc gccatctgcg 481 gggaccgctc ctcaggcaag cactatggag tgtacagctg cgaggggtgc aagggcttct 541 tcaagcggac ggtgcgcaag gacctgacct acacctgccg cgacaacaag gactgcctga 601 ttgacaagcg gcagcggaac cggtgccagt actgccgcta ccagaagtgc ctggccatgg 661 gcatgaagcg ggaagccgtg caggaggagc ggcagcgtgg caaggaccgg aacgagaatg 721 aggtggagtc gaccagcagc gccaacgagg acatgccggt ggagaggatc ctggaggctg 781 agctggccgt ggagcccaag accgagacct acgtggaggc aaacatgggg ctgaacccca 841 gctcgccgaa cgaccctgtc accaacattt gccaagcagc cgacaaacag cttttcaccc 901 tggtggagtg ggccaagcgg atcccacact tctcagagct gcccctggac gaccaggtca 961 tcctgctgcg ggcaggctgg aatgagctgc tcatcgcctc cttctcccac cgctccatcg 1021 ccgtgaagga cgggatcctc ctggccaccg ggctgcacgt ccaccggaac agcgcccaca 1081 gcgcaggggt gGGCGCCATC TTTGACAGGG TGCTGACGGA GCTTGTGTCC AAGATGCGGG 1141 ACATGCAGAT GGACAAGACG GAGCTGGGCT GCCTGCGCGC CATCGTCCTC TTTAACCCTG 1201 ACTCCAAGGG GCTCTCGAAC CCGGCCGAGG TGGAGGCGCT GAGGGAGAAG GTCTATGCGT 1261 CCTTGGAGGC CTACTGCAAG CACAAGTACC CAGAGCAGCC GGGAAGGTTC GCTAAGCTCT 1321 TGCTCCGCCT GCCGGCTCTG CGCTCCATCG GGCTCAAATG CCTGGAACAT CTCTTCTTCT 1381 TCAAGCTCAT CGGGGACACA CCCATTGACA CCTTCCTTAT GGAGATGCTG GAGGCGCCGC 1441 ACCAAATGAC TGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1501 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1561 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACCA ATTGAGACCT TTACGATGCA 1621 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t