Transcript: Mouse NM_011305.3

Mus musculus retinoid X receptor alpha (Rxra), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rxra (20181)
Length:
5267
CDS:
233..1636

Additional Resources:

NCBI RefSeq record:
NM_011305.3
NBCI Gene record:
Rxra (20181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222394 CTCAGGAAATATGGCCTCCTT pLKO.1 616 CDS 100% 2.640 2.112 N Rxra n/a
2 TRCN0000222395 CCTGTTACCAACATCTGTCAA pLKO.1 1037 CDS 100% 4.950 3.465 N Rxra n/a
3 TRCN0000222393 CCTGTTCAACCCTGACTCTAA pLKO.1 1369 CDS 100% 4.950 3.465 N Rxra n/a
4 TRCN0000222392 CCTGTAGAGAAGATTCTGGAA pLKO.1 938 CDS 100% 2.640 1.848 N Rxra n/a
5 TRCN0000222391 CCAGCTCAATTCACCCATGAA pLKO.1 523 CDS 100% 4.950 2.970 N Rxra n/a
6 TRCN0000338870 ATGACCCTGTTACCAACATAT pLKO_005 1032 CDS 100% 13.200 6.600 Y RXRG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489413 CCAATTGAGACCTTTACGATGCAA pLX_317 26.3% 88% 97.2% V5 (many diffs) n/a
Download CSV