Transcript: Human NM_002957.6

Homo sapiens retinoid X receptor alpha (RXRA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
RXRA (6256)
Length:
5537
CDS:
178..1566

Additional Resources:

NCBI RefSeq record:
NM_002957.6
NBCI Gene record:
RXRA (6256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002957.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021618 CGATTTCTCCACCCAGGTGAA pLKO.1 204 CDS 100% 4.050 5.670 N RXRA n/a
2 TRCN0000330783 GTGTTGTCACCCTCCTTATTT pLKO_005 1716 3UTR 100% 15.000 10.500 N RXRA n/a
3 TRCN0000330707 CAAGGACTGCCTGATTGACAA pLKO_005 699 CDS 100% 4.950 3.465 N RXRA n/a
4 TRCN0000021616 GCAAGCACTATGGAGTGTACA pLKO.1 608 CDS 100% 4.950 3.465 N RXRA n/a
5 TRCN0000330784 TGCGCTCCATCGGGCTCAAAT pLKO_005 1451 CDS 100% 4.400 3.080 N RXRA n/a
6 TRCN0000021615 CCTCTTTAACCCTGACTCCAA pLKO.1 1299 CDS 100% 2.640 1.848 N RXRA n/a
7 TRCN0000021614 CCTGTCACCAACATTTGCCAA pLKO.1 967 CDS 100% 2.640 1.848 N RXRA n/a
8 TRCN0000021617 GCGGGACATGCAGATGGACAA pLKO.1 1248 CDS 100% 1.350 0.945 N RXRA n/a
9 TRCN0000330782 GCGGGACATGCAGATGGACAA pLKO_005 1248 CDS 100% 1.350 0.945 N RXRA n/a
10 TRCN0000330706 ACGACCCTGTCACCAACATTT pLKO_005 962 CDS 100% 13.200 7.920 N RXRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002957.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489413 CCAATTGAGACCTTTACGATGCAA pLX_317 26.3% 99.9% 99.7% V5 1386_1387insG n/a
Download CSV