Construct: ORF TRCN0000489435
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020879.1_s317c1
- DNA Barcode:
- GCGGTCTGTCCATCACTCAGCATT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NPY5R (4889)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489435
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | NM_001317091.1 | 100% | 100% | |
| 2 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | NM_001317092.1 | 100% | 100% | |
| 3 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | NM_006174.4 | 100% | 100% | |
| 4 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | XM_005263038.3 | 100% | 100% | |
| 5 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | XM_011532017.2 | 100% | 100% | |
| 6 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | XM_011532015.2 | 98.4% | 98.4% | 1_21del |
| 7 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | XM_017008255.1 | 98.4% | 98.4% | 1_21del |
| 8 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | XM_017008256.1 | 98.4% | 98.4% | 1_21del |
| 9 | mouse | 18168 | Npy5r | neuropeptide Y receptor Y5 | NM_016708.3 | 81.4% | 85% | (many diffs) |
| 10 | mouse | 18168 | Npy5r | neuropeptide Y receptor Y5 | XM_006509598.3 | 81.4% | 85% | (many diffs) |
| 11 | mouse | 18168 | Npy5r | neuropeptide Y receptor Y5 | XM_006509599.3 | 81.4% | 85% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1407
- ORF length:
- 1335
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggattta gagctcgacg agtattataa caagacactt gccacagaga 121 ataatactgc tgccactcgg aattctgatt tcccagtctg ggatgactat aaaagcagtg 181 tagatgactt acagtatttt ctgattgggc tctatacatt tgtaagtctt cttggcttta 241 tggggaatct acttatttta atggctctca tgaaaaagcg taatcagaag actacggtaa 301 acttcctcat aggcaatctg gccttttctg atatcttggt tgtgctgttt tgctcacctt 361 tcacactgac gtctgtcttg ctggatcagt ggatgtttgg caaagtcatg tgccatatta 421 tgccttttct tcaatgtgtg tcagttttgg tttcaacttt aattttaata tcaattgcca 481 ttgtcaggta tcatatgata aaacatccca tatctaataa tttaacagca aaccatggct 541 actttctgat agctactgtc tggacactag gttttgccat ctgttctccc cttccagtgt 601 ttcacagtct tgtggaactt caagaaacat ttggttcagc attgctgagc agcaggtatt 661 tatgtgttga gtcatggcca tctgattcat acagaattgc ctttactatc tctttattgc 721 tagttcagta tattctgccc ttagtttgtc ttactgtaag tcatacaagt gtctgcagaa 781 gtataagctg tggattgtcc aacaaagaaa acagacttga agaaaatgag atgatcaact 841 taactcttca tccatccaaa aagagtgggc ctcaggtgaa actctctggc agccataaat 901 ggagttattc attcatcaaa aaacacagaa gaagatatag caagaagaca gcatgtgtgt 961 tacctgctcc agaaagacct tctcaagaga accactccag aatacttcca gaaaactttg 1021 gctctgtaag aagtcagctc tcttcatcca gtaagttcat accaggggtc ccCACTTGCT 1081 TTGAGATAAA ACCTGAAGAA AATTCAGATG TTCATGAATT GAGAGTAAAA CGTTCTGTTA 1141 CAAGAATAAA AAAGAGATCT CGAAGTGTTT TCTACAGACT GACCATACTG ATATTAGTAT 1201 TTGCTGTTAG TTGGATGCCA CTACACCTTT TCCATGTGGT AACTGATTTT AATGACAATC 1261 TTATTTCAAA TAGGCATTTC AAGTTGGTGT ATTGCATTTG TCATTTGTTG GGCATGATGT 1321 CCTGTTGTCT TAATCCAATT CTATATGGGT TTCTTAATAA TGGGATTAAA GCTGATTTAG 1381 TGTCCCTTAT ACACTGTCTT CATATGTAGG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 1441 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1501 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGCGGT 1561 CTGTCCATCA CTCAGCATTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1621 tgaaagatt