Construct: ORF TRCN0000489437
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020806.1_s317c1
- DNA Barcode:
- CCGGATTACAAACGAACAAAACAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR4 (2828)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489437
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2828 | GPR4 | G protein-coupled receptor 4 | NM_005282.3 | 100% | 100% | |
| 2 | human | 2828 | GPR4 | G protein-coupled receptor 4 | XM_017026607.2 | 100% | 100% | |
| 3 | human | 2828 | GPR4 | G protein-coupled receptor 4 | XM_017026608.1 | 100% | 100% | |
| 4 | mouse | 319197 | Gpr4 | G protein-coupled receptor 4 | NM_175668.4 | 86.7% | 91.5% | (many diffs) |
| 5 | mouse | 319197 | Gpr4 | G protein-coupled receptor 4 | XM_006540048.3 | 86.7% | 91.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1158
- ORF length:
- 1086
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgggcaac cacacgtggg agggctgcca cgtggactcg cgcgtggacc 121 acctctttcc gccatccctc tacatctttg tcatcggcgt ggggctgccc accaactgcc 181 tggctctgtg ggcggcctac cgccaggtgc aacagcgcaa cgagctgggc gtctacctga 241 tgaacctcag catcgccgac ctgctgtaca tctgcacgct gccgctgtgg gtggactact 301 tcctgcacca cgacaactgg atccacggcc ccgggtcctg caagctcttt gggttcatct 361 tctacaccaa tatctacatc agcatcgcct tcctgtgctg catctcggtg gaccgctacc 421 tggctgtggc ccacccactc cgcttcgccc gcctgcgccg cgtcaagacc gccgtggccg 481 tgagctccgt ggtctgggcc acggagctgg gcgccaactc ggcgcccctg ttccatgacg 541 agctcttccg agaccgctac aaccacacct tctgctttga gaagttcccc atggaaggct 601 gggtggcctg gatgaacctc tatcgggtgt tcgtgggctt cctcttcccg tgggcgctca 661 tgctgctgtc gtaccggggc atcctgcggg ccgtgcgggg cagcgtgtcc accgagcgcc 721 aggagaaggc caagatcaag cggctggccc tcagcctcat cgccatcgtg ctggtctgct 781 ttgcgcccta tcacgtgctc ttgctgtccc gcagcgccat ctacctgggC CGCCCCTGGG 841 ACTGCGGCTT CGAGGAGCGC GTCTTTTCTG CATACCACAG CTCACTGGCT TTCACCAGCC 901 TCAACTGTGT GGCGGACCCC ATCCTCTACT GCCTGGTCAA CGAGGGCGCC CGCAGCGATG 961 TGGCCAAGGC CCTGCACAAC CTGCTCCGCT TTCTGGCCAG CGACAAGCCC CAGGAGATGG 1021 CCAATGCCTC GCTCACCCTG GAGACCCCAC TCACCTCCAA GAGGAACAGC ACAGCCAAAG 1081 CCATGACTGG CAGCTGGGCG GCCACTCCGC CCTCCCAGGG GGACCAGGTG CAGCTGAAGA 1141 TGCTGCCGCC AGCACAATAG GACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1201 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1261 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACCGG ATTACAAACG 1321 AACAAAACAC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt