Construct: ORF TRCN0000489439
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020235.1_s317c1
- DNA Barcode:
- TGGGGACTCGCATTTTCGGGAGAG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GALK2 (2585)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489439
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2585 | GALK2 | galactokinase 2 | NM_002044.4 | 99.9% | 100% | 1221C>T |
| 2 | human | 2585 | GALK2 | galactokinase 2 | XM_005254279.4 | 98% | 96.9% | (many diffs) |
| 3 | human | 2585 | GALK2 | galactokinase 2 | XM_006720461.4 | 97.6% | 97.1% | (many diffs) |
| 4 | human | 2585 | GALK2 | galactokinase 2 | NM_001001556.3 | 96.3% | 96.2% | (many diffs) |
| 5 | human | 2585 | GALK2 | galactokinase 2 | NM_001289030.2 | 94.6% | 94.7% | 0_1ins72;1149C>T |
| 6 | human | 2585 | GALK2 | galactokinase 2 | NM_001289031.1 | 94.6% | 94.7% | 0_1ins72;1149C>T |
| 7 | human | 2585 | GALK2 | galactokinase 2 | XM_005254280.4 | 94.4% | 93.3% | (many diffs) |
| 8 | human | 2585 | GALK2 | galactokinase 2 | XM_006720462.4 | 92.8% | 91.8% | (many diffs) |
| 9 | human | 2585 | GALK2 | galactokinase 2 | XM_024449892.1 | 92.8% | 91.8% | (many diffs) |
| 10 | human | 2585 | GALK2 | galactokinase 2 | XM_006720463.4 | 90.9% | 89.9% | (many diffs) |
| 11 | human | 2585 | GALK2 | galactokinase 2 | XM_017022062.2 | 87.4% | 87.5% | 0_1ins72;432_433ins99;1050C>T |
| 12 | human | 2585 | GALK2 | galactokinase 2 | XM_005254284.4 | 87.4% | 86.2% | (many diffs) |
| 13 | human | 2585 | GALK2 | galactokinase 2 | XM_024449893.1 | 86.9% | 86.3% | (many diffs) |
| 14 | human | 2585 | GALK2 | galactokinase 2 | XM_024449894.1 | 85.7% | 84.7% | (many diffs) |
| 15 | human | 2585 | GALK2 | galactokinase 2 | XM_006720464.4 | 79.9% | 78.9% | (many diffs) |
| 16 | human | 2585 | GALK2 | galactokinase 2 | XM_017022063.2 | 76.4% | 75.3% | (many diffs) |
| 17 | human | 2585 | GALK2 | galactokinase 2 | XM_011521441.3 | 70.2% | 69.3% | (many diffs) |
| 18 | human | 2585 | GALK2 | galactokinase 2 | XM_017022064.2 | 70.2% | 69.3% | (many diffs) |
| 19 | human | 2585 | GALK2 | galactokinase 2 | NM_001352047.1 | 69.7% | 69.3% | (many diffs) |
| 20 | human | 2585 | GALK2 | galactokinase 2 | NM_001352048.1 | 69.7% | 69.3% | (many diffs) |
| 21 | human | 2585 | GALK2 | galactokinase 2 | XM_024449895.1 | 64.5% | 64.6% | 0_1ins387;117_118ins99;735C>T |
| 22 | human | 2585 | GALK2 | galactokinase 2 | XR_001751207.2 | 63.6% | 1_91del;1058_1227del;1302_1303ins333 | |
| 23 | human | 2585 | GALK2 | galactokinase 2 | XR_001751204.2 | 33% | (many diffs) | |
| 24 | human | 2585 | GALK2 | galactokinase 2 | XR_001751202.2 | 32.3% | (many diffs) | |
| 25 | human | 2585 | GALK2 | galactokinase 2 | XR_001751205.2 | 31.9% | (many diffs) | |
| 26 | human | 2585 | GALK2 | galactokinase 2 | XR_002957633.1 | 31.3% | (many diffs) | |
| 27 | human | 2585 | GALK2 | galactokinase 2 | XR_001751206.2 | 31% | (many diffs) | |
| 28 | human | 2585 | GALK2 | galactokinase 2 | XR_001751208.2 | 30% | (many diffs) | |
| 29 | human | 2585 | GALK2 | galactokinase 2 | NR_147895.2 | 26.2% | (many diffs) | |
| 30 | mouse | 69976 | Galk2 | galactokinase 2 | NM_001291002.1 | 84.9% | 88.8% | (many diffs) |
| 31 | mouse | 69976 | Galk2 | galactokinase 2 | NM_175154.3 | 82% | 85% | (many diffs) |
| 32 | mouse | 69976 | Galk2 | galactokinase 2 | XM_006500153.3 | 80.6% | 84% | (many diffs) |
| 33 | mouse | 69976 | Galk2 | galactokinase 2 | XM_011239770.2 | 80.6% | 84% | (many diffs) |
| 34 | mouse | 69976 | Galk2 | galactokinase 2 | XM_006500154.1 | 69.8% | 70% | (many diffs) |
| 35 | mouse | 69976 | Galk2 | galactokinase 2 | XM_011239772.1 | 49.7% | 51% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1446
- ORF length:
- 1374
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggctaca gagagccctg ctacgcgtcg ggtccaggtg gcagaacatc 121 ctaggttact gaagctaaag gagatgttta actccaagtt tggatctatt cccaagtttt 181 atgttcgagc accaggaaga gtcaacataa taggagagca tatagattat tgtggatatt 241 ctgttcttcc tatggctgta gaacaagatg tgctaatagc tgtagaacct gtgaaaacgt 301 acgctctcca actggccaat acaaatccct tgtatccgga cttcagtact agtgctaata 361 acatccagat tgataaaacc aagcctttgt ggcacaacta tttcttatgt ggacttaaag 421 gaattcagga acactttggt cttagtaacc tgactggaat gaactgcctg gtagatggaa 481 atatcccacc aagttctggc ctctccagct ccagtgcttt ggtctgttgt gctggcttgg 541 tgacgctcac agtgctggga aggaatctat ccaaggtgga acttgcagaa atctgtgcca 601 agagtgagcg ttacattggc actgaaggag gaggcatgga ccagtctata tcatttcttg 661 cagaagaagg aactgccaag ttgatagaat ttagtcctct gagggcaacc gatgtaaaac 721 tcccaagtgg agcagtgttt gtgattgcca acagttgtgt ggagatgaat aaggcagcaa 781 cttcccattt caatatcagg gtgatggagt gtcggctggc tgcgaagctc ctggctaaat 841 acaaaagctt gcaatgggac aaagtactga ggctggagga ggtgcaggct aaactaggga 901 ttagtctaga agaaatgctg ttggtcacag aagatgccct tcatcctgaa ccctataacc 961 ctgaggagat ctgcaggtgt ctgggaatta gcctggagga actccgaacc caaatcctga 1021 gtccaaacac tcaagatgtg ctcaTCTTCA AACTCTATCA GCGGGCAAAG CATGTGTACA 1081 GCGAGGCTGC GCGAGTGCTC CAGTTTAAGA AGATATGTGA AGAAGCACCT GAAAACATGG 1141 TCCAGCTGCT GGGAGAGTTG ATGAACCAGA GCCACATGAG CTGCCGGGAC ATGTATGAGT 1201 GCAGCTGCCC CGAGCTGGAT CAGCTGGTGG ACATCTGTCG GAAGTTTGGG GCTCAAGGGT 1261 CACGACTTAC TGGAGCAGGA TGGGGAGGCT GTACAGTATC AATGGTACCT GCGGACAAGC 1321 TGCCCAGCTT TCTAGCAAAT GTGCACAAAG CTTATTACCA GAGGAGTGAT GGAAGCTTAG 1381 CACCGGAGAA GCAAAGTTTG TTTGCTACCA AACCTGGAGG TGGGGCTTTG GTTTTGCTTG 1441 AGGCCTGAGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1501 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1561 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATGGGGA CTCGCATTTT CGGGAGAGAC 1621 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt