Transcript: Human NM_001289031.1

Homo sapiens galactokinase 2 (GALK2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
GALK2 (2585)
Length:
3313
CDS:
363..1667

Additional Resources:

NCBI RefSeq record:
NM_001289031.1
NBCI Gene record:
GALK2 (2585)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146958 GGTGCTCGAACATAAAACTT pXPR_003 GGG 33 3% 2 0.7696 GALK2 GALK2 76768
2 BRDN0001146237 GCCAAGAGTGAGCGTTACAT pXPR_003 TGG 470 36% 6 0.5812 GALK2 GALK2 76769
3 BRDN0001145171 TTAAATACTCACGGATACAA pXPR_003 GGG 189 14% 3 0.2767 GALK2 GALK2 76767
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199906 GCGAAGCTCCTGGCTAAATAC pLKO.1 1041 CDS 100% 13.200 18.480 N GALK2 n/a
2 TRCN0000010092 TCTGAGGGCAACCGATGTAAA pLKO.1 917 CDS 100% 13.200 18.480 N GALK2 n/a
3 TRCN0000194870 CGGTTGCTATTATATCAAGAT pLKO.1 1773 3UTR 100% 4.950 6.930 N GALK2 n/a
4 TRCN0000342572 CGGTTGCTATTATATCAAGAT pLKO_005 1773 3UTR 100% 4.950 6.930 N GALK2 n/a
5 TRCN0000196510 GCTATCTCCATTACTTAATAG pLKO.1 2394 3UTR 100% 13.200 10.560 N GALK2 n/a
6 TRCN0000194934 CAAAGTTTGTTTGCTACCAAA pLKO.1 1611 CDS 100% 4.950 3.960 N GALK2 n/a
7 TRCN0000194653 CTGCCAAGTTGATAGAATTTA pLKO.1 892 CDS 100% 15.000 10.500 N GALK2 n/a
8 TRCN0000196679 GCTGAAATACTCAGGTAATTG pLKO.1 2867 3UTR 100% 13.200 9.240 N GALK2 n/a
9 TRCN0000197271 GCCAAGAGTGAGCGTTACATT pLKO.1 816 CDS 100% 5.625 3.938 N GALK2 n/a
10 TRCN0000342569 GCCAAGAGTGAGCGTTACATT pLKO_005 816 CDS 100% 5.625 3.938 N GALK2 n/a
11 TRCN0000010093 GGCAGCAACTTCCCATTTCAA pLKO.1 992 CDS 100% 5.625 3.938 N GALK2 n/a
12 TRCN0000010100 CACCGGAGAAGCAAAGTTTGT pLKO.1 1600 CDS 100% 4.950 3.465 N GALK2 n/a
13 TRCN0000342571 CACCGGAGAAGCAAAGTTTGT pLKO_005 1600 CDS 100% 4.950 3.465 N GALK2 n/a
14 TRCN0000024642 CCAAGGTGGAACTTGCAGAAA pLKO.1 790 CDS 100% 4.950 3.465 N Galk2 n/a
15 TRCN0000278674 CCAAGGTGGAACTTGCAGAAA pLKO_005 790 CDS 100% 4.950 3.465 N Galk2 n/a
16 TRCN0000010099 GCTGCTGGGAGAGTTGATGAA pLKO.1 1364 CDS 100% 4.950 3.465 N GALK2 n/a
17 TRCN0000342570 GCTGCTGGGAGAGTTGATGAA pLKO_005 1364 CDS 100% 4.950 3.465 N GALK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06251 pDONR223 100% 94.6% 94.7% None 0_1ins72;1149C>T n/a
2 ccsbBroad304_06251 pLX_304 0% 94.6% 94.7% V5 0_1ins72;1149C>T n/a
3 TRCN0000471462 GAGCCGTCTCTGATTGCCTGGCAG pLX_317 32.5% 94.6% 94.7% V5 0_1ins72;1149C>T n/a
4 ccsbBroadEn_14652 pDONR223 0% 94.6% 94.7% None 0_1ins72;1149C>T n/a
5 ccsbBroad304_14652 pLX_304 0% 94.6% 94.7% V5 0_1ins72;1149C>T n/a
6 TRCN0000481375 GTTCAACTCTAATCACCCACGGGC pLX_317 29.7% 94.6% 94.7% V5 0_1ins72;1149C>T n/a
7 TRCN0000489439 TGGGGACTCGCATTTTCGGGAGAG pLX_317 29.5% 94.6% 94.7% V5 (not translated due to prior stop codon) 0_1ins72;1149C>T n/a
8 TRCN0000492356 ATTAACTTACTCAAGTGTGTTCCT pLX_317 29.3% 94.6% 94.5% V5 0_1ins72;1149C>T;1302_1303insG n/a
Download CSV