Construct: ORF TRCN0000489445
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019716.1_s317c1
- DNA Barcode:
- CATGAACCATAATCTGTGACGGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CHUK (1147)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489445
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1147 | CHUK | component of inhibitor of n... | NM_001278.5 | 99.9% | 99.8% | 2235_2236insG |
| 2 | human | 1147 | CHUK | component of inhibitor of n... | NM_001320928.1 | 96.4% | 93.7% | 2090_2091insGGTAACTCCTCAAGATG;2157_2158ins62 |
| 3 | human | 1147 | CHUK | component of inhibitor of n... | XM_017015611.1 | 91.1% | 90.6% | (many diffs) |
| 4 | human | 1147 | CHUK | component of inhibitor of n... | XM_017015612.1 | 79.1% | 77.6% | (many diffs) |
| 5 | human | 1147 | CHUK | component of inhibitor of n... | XR_001747011.1 | 60% | 1_78del;1206_1207ins103;2211_3445delinsG | |
| 6 | human | 1147 | CHUK | component of inhibitor of n... | XR_001747010.1 | 59.3% | 1_78del;2186_2420del;2549_3764delinsG | |
| 7 | human | 1147 | CHUK | component of inhibitor of n... | XM_017015613.1 | 41.5% | 40.2% | (many diffs) |
| 8 | mouse | 12675 | Chuk | conserved helix-loop-helix ... | NM_007700.2 | 92.4% | 95.1% | (many diffs) |
| 9 | mouse | 12675 | Chuk | conserved helix-loop-helix ... | NM_001162410.1 | 89.2% | 88.7% | (many diffs) |
| 10 | mouse | 12675 | Chuk | conserved helix-loop-helix ... | XM_011247129.2 | 86.4% | 88.4% | (many diffs) |
| 11 | mouse | 12675 | Chuk | conserved helix-loop-helix ... | XR_001782558.1 | 65.7% | (many diffs) | |
| 12 | mouse | 12675 | Chuk | conserved helix-loop-helix ... | XR_001782557.1 | 32.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 2313
- ORF length:
- 2238
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggag cggcccccgg ggctgcggcc gggcgcgggc gggccctggg 121 agatgcggga gcggctgggc accggcggct tcgggaacgt ctgtctgtac cagcatcggg 181 aacttgatct caaaatagca attaagtctt gtcgcctaga gctaagtacc aaaaacagag 241 aacgatggtg ccatgaaatc cagattatga agaagttgaa ccatgccaat gttgtaaagg 301 cctgtgatgt tcctgaagaa ttgaatattt tgattcatga tgtgcctctt ctagcaatgg 361 aatactgttc tggaggagat ctccgaaagc tgctcaacaa accagaaaat tgttgtggac 421 ttaaagaaag ccagatactt tctttactaa gtgatatagg gtctgggatt cgatatttgc 481 atgaaaacaa aattatacat cgagatctaa aacctgaaaa catagttctt caggatgttg 541 gtggaaagat aatacataaa ataattgatc tgggatatgc caaagatgtt gatcaaggaa 601 gtctgtgtac atcttttgtg ggaacactgc agtatctggc cccagagctc tttgagaata 661 agccttacac agccactgtt gattattgga gctttgggac catggtattt gaatgtattg 721 ctggatatag gccttttttg catcatctgc agccatttac ctggcatgag aagattaaga 781 agaaggatcc aaagtgtata tttgcatgtg aagagatgtc aggagaagtt cggtttagta 841 gccatttacc tcaaccaaat agcctttgta gtttagtagt agaacccatg gaaaactggc 901 tacagttgat gttgaattgg gaccctcagc agagaggagg acctgttgac cttactttga 961 agcagccaag atgttttgta ttaatggatc acattttgaa tttgaagata gtacacatcc 1021 taaatatgac ttctgcaaag ataatttctt ttctgttacc acctgatgaa agtcttcatt 1081 cactacagtc tcgtattgag cgtgaaactg gaataaatac tggttctcaa gaacttcttt 1141 cagagacagg aatttctctg gatcctcgga aaccagcctc tcaatgtgtt ctagatggag 1201 ttagaggctg tgatagctat atggtttatt tgtttgataa aagtaaaact gtatatgaag 1261 ggccatttgc ttccagaagt ttatctgatt gtgtaaatta tattgtacag gacagcaaaa 1321 tacagcttcc aattatacag ctgcgtaaag tgtgggctga agcagtgcac tatgtgtctg 1381 gactaaaaga agactatagc aggctctttc agggacaaag ggcagcaatg ttaagtcttc 1441 ttagatataa tgctaactta acaaaaatga agaacacttt gatctcagca tcacaacaac 1501 tgaaagctaa attggagttt tttcacaaaa gcattcagct tgacttggag agatacagcg 1561 agcagatgac gtatgggata tcttcagaaa aaatgctaaa agcatggaaa gaaatggaag 1621 aaaaggccat ccactatgct gaggttggtg tcattggata cctggaggat cagattatgt 1681 ctttgcatgc tgaaatcatg gagctacaga agagccccta tggaagacgt cagggagact 1741 tgatggaatc tctggaacag cgtgccattg atctatataa gcagttaaaa cacagacctt 1801 cagatcactc ctacagtgac agcacagaga tggtgaaaat cattgtgcac actgtgcaga 1861 gtcaggaccg tgtgctcaag gagctgtttg gtcatttgag caagttgttg ggctgtaagc 1921 agaagattat tgatctactc cctaaggtgg aagtggCCCT CAGTAATATC AAAGAAGCTG 1981 ACAATACTGT CATGTTCATG CAGGGAAAAA GGCAGAAAGA AATATGGCAT CTCCTTAAAA 2041 TTGCCTGTAC ACAGAGTTCT GCCCGGTCCC TTGTAGGATC CAGTCTAGAA GGTGCAGTAA 2101 CCCCTCAGAC ATCAGCATGG CTGCCCCCGA CTTCAGCAGA ACATGATCAT TCTCTGTCAT 2161 GTGTGGTAAC TCCTCAAGAT GGGGAGACTT CAGCACAAAT GATAGAAGAA AATTTGAACT 2221 GCCTTGGCCA TTTAAGCACT ATTATTCATG AGGCAAATGA GGAACAGGGC AATAGTATGA 2281 TGAATCTTGA TTGGAGTTGG TTAACAGAAG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 2341 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 2401 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACATGA 2461 ACCATAATCT GTGACGGGAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 2521 tgaaagatt