Construct: ORF TRCN0000489462
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021082.1_s317c1
- DNA Barcode:
- ATATGCCCAGCCTCCCGTTAATTA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- SSTR3 (6753)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489462
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6753 | SSTR3 | somatostatin receptor 3 | NM_001051.5 | 99.6% | 100% | (many diffs) |
| 2 | human | 6753 | SSTR3 | somatostatin receptor 3 | NM_001278687.2 | 99.6% | 100% | (many diffs) |
| 3 | human | 6753 | SSTR3 | somatostatin receptor 3 | XM_005261721.4 | 99.6% | 100% | (many diffs) |
| 4 | human | 6753 | SSTR3 | somatostatin receptor 3 | XM_006724311.3 | 99.6% | 100% | (many diffs) |
| 5 | human | 6753 | SSTR3 | somatostatin receptor 3 | XM_011530349.2 | 99.6% | 100% | (many diffs) |
| 6 | human | 6753 | SSTR3 | somatostatin receptor 3 | XM_017028923.1 | 99.6% | 100% | (many diffs) |
| 7 | human | 6753 | SSTR3 | somatostatin receptor 3 | XM_017028924.1 | 99.6% | 100% | (many diffs) |
| 8 | mouse | 20607 | Sstr3 | somatostatin receptor 3 | NM_009218.3 | 82.2% | 83.2% | (many diffs) |
| 9 | mouse | 20607 | Sstr3 | somatostatin receptor 3 | XM_006520669.3 | 82.2% | 83.2% | (many diffs) |
| 10 | mouse | 20607 | Sstr3 | somatostatin receptor 3 | XM_006520670.3 | 82.2% | 83.2% | (many diffs) |
| 11 | mouse | 20607 | Sstr3 | somatostatin receptor 3 | XM_011245531.1 | 82.2% | 83.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1326
- ORF length:
- 1254
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggacatg cttcatccat catcggtgtc cacgacctca gaacctgaga 121 atgcctcctc ggcctggccc ccagatgcca ccctgggcaa cgtgtcggca ggcccaagcc 181 cggcagggct ggccgtcagt ggcgttctga tccccctggt ctacctggtg gtgtgcgtgg 241 tgggcctgct gggtaactcg ctggtcatct atgtggtcct gcggcacacg gccagccctt 301 cagtcaccaa cgtctacatc ctcaacctgg cgctggccga cgagctcttc atgctggggc 361 tgcccttcct ggccgcccag aacgccctgt cctactggcc cttcggctcc ctcatgtgcc 421 gcctggtcat ggcggtggat ggcatcaacc agttcaccag catattctgc ctgactgtca 481 tgagcgtgga ccgctacctg gccgtggtac atcccacccg ctcagcccgc tggcgcacag 541 ctccggtggc ccgcacggtc agcgcggctg tgtgggtggc ctcagccgtg gtggtgctgc 601 ccgtggtggt cttctcggga gtgccccgcg gcatgagcac ctgccacatg cagtggcccg 661 agccggcggc ggcctggcga gccggcttca tcatctacac ggccgcactg ggcttcttcg 721 ggccgctgct ggtcatctgc ctctgctacc tgctcatcgt ggtgaaggtg cgctcagctg 781 ggcgccgggt gtgggcaccc tcgtgccagc ggcggcggcg ctccgaacgc agggtcacgc 841 gcatggtggt ggccgtggtg gcactcttcg tgctctgctg gatgcccttc tatgtgctca 901 acatcgtcaa cgtggtgtgc ccactgcccg aggagcctgc cttctttggg ctctacttcc 961 tggtggtggc gctgccctat gccaacagct gtgccaaccc catcctttat ggcttcctct 1021 cctaccgctt caagcagggc ttccgcaggg tccTGCTGCG GCCCTCCCGC CGTGTGCGCA 1081 GCCAGGAGCC CACTGTGGGG CCCCCGGAGA AGACTGAGGA GGAGGATGAG GAGGAGGAGG 1141 ATGGGGAGGA GAGCAGGGAG GGGGGCAAGG GGAAGGAGAT GAACGGCCGG GTCAGCCAGA 1201 TCACGCAGCC TGGCACCAGC GGGCAGGAGC GGCCGCCCAG CAGAGTGGCC AGCAAGGAGC 1261 AGCAGCTCCT ACCCCAAGAG GCTTCCACTG GGGAGAAGTC CAGCACGATG CGCATCAGCT 1321 ACCTGTAGGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1381 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1441 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAATATGC CCAGCCTCCC GTTAATTAAC 1501 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt